ID: 1128321978

View in Genome Browser
Species Human (GRCh38)
Location 15:66701043-66701065
Sequence CTTTCATTCAGCGCGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128321969_1128321978 9 Left 1128321969 15:66701011-66701033 CCAGCCCCGGGCCAATGAGAGTA No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data
1128321968_1128321978 10 Left 1128321968 15:66701010-66701032 CCCAGCCCCGGGCCAATGAGAGT No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data
1128321974_1128321978 -2 Left 1128321974 15:66701022-66701044 CCAATGAGAGTAGCGGAATTTCT No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data
1128321970_1128321978 5 Left 1128321970 15:66701015-66701037 CCCCGGGCCAATGAGAGTAGCGG No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data
1128321965_1128321978 26 Left 1128321965 15:66700994-66701016 CCGCGGGGGAATGGCGCCCAGCC No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data
1128321973_1128321978 3 Left 1128321973 15:66701017-66701039 CCGGGCCAATGAGAGTAGCGGAA No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data
1128321972_1128321978 4 Left 1128321972 15:66701016-66701038 CCCGGGCCAATGAGAGTAGCGGA No data
Right 1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128321978 Original CRISPR CTTTCATTCAGCGCGGGGCC AGG Intergenic
No off target data available for this crispr