ID: 1128322452

View in Genome Browser
Species Human (GRCh38)
Location 15:66703095-66703117
Sequence TGTCGTCGAAGGGGCGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128322452_1128322464 25 Left 1128322452 15:66703095-66703117 CCTGCGGCGCCCCTTCGACGACA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1128322464 15:66703143-66703165 CCGCGGCGGAGCTTCATGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 34
1128322452_1128322458 -2 Left 1128322452 15:66703095-66703117 CCTGCGGCGCCCCTTCGACGACA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1128322458 15:66703116-66703138 CAGGCTGTGCGCGGTCTGCACGG 0: 1
1: 0
2: 1
3: 6
4: 116
1128322452_1128322461 23 Left 1128322452 15:66703095-66703117 CCTGCGGCGCCCCTTCGACGACA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1128322461 15:66703141-66703163 CTCCGCGGCGGAGCTTCATGTGG 0: 1
1: 0
2: 0
3: 1
4: 27
1128322452_1128322460 11 Left 1128322452 15:66703095-66703117 CCTGCGGCGCCCCTTCGACGACA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1128322460 15:66703129-66703151 GTCTGCACGGCGCTCCGCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 37
1128322452_1128322459 8 Left 1128322452 15:66703095-66703117 CCTGCGGCGCCCCTTCGACGACA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1128322459 15:66703126-66703148 GCGGTCTGCACGGCGCTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 58
1128322452_1128322462 24 Left 1128322452 15:66703095-66703117 CCTGCGGCGCCCCTTCGACGACA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1128322462 15:66703142-66703164 TCCGCGGCGGAGCTTCATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128322452 Original CRISPR TGTCGTCGAAGGGGCGCCGC AGG (reversed) Exonic
907442483 1:54487848-54487870 TGTCGGCGAAGGGGAGCCCCTGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
1083759879 11:64810055-64810077 CGTCGTCGATGGAGCGCAGCGGG + Exonic
1100329393 12:93570558-93570580 TCGCATCGAGGGGGCGCCGCCGG + Intronic
1103415755 12:120740686-120740708 TGTCATCAAAGGGGCGCCCAGGG + Intergenic
1120475702 14:84984255-84984277 TGTTGTAGAAGGGGCCCGGCGGG - Intergenic
1128075702 15:64824053-64824075 TGTCGTGGGCGGGGAGCCGCAGG + Exonic
1128322452 15:66703095-66703117 TGTCGTCGAAGGGGCGCCGCAGG - Exonic
1140209173 16:72957758-72957780 GGTCGGCGAGGGGGCCCCGCAGG + Exonic
1148440480 17:47709245-47709267 TGCCCTCGAAGGCGCGCCGCGGG - Exonic
1157599452 18:48885234-48885256 TGTCCTCGAGGGAGCGCCTCGGG + Intergenic
1158601966 18:58863615-58863637 TGTCGTCGGAGCGGCGGCGGCGG - Intronic
1163758252 19:19119766-19119788 CGGCGTCCAAGGGGGGCCGCGGG + Exonic
1165227515 19:34365341-34365363 TGGCATCGAAGAGGCGGCGCAGG - Exonic
927794235 2:26034259-26034281 TGCCGTCGAGGAGGCGCAGCGGG - Exonic
936259563 2:110947402-110947424 TGTCATGGAAGGGGAGCTGCTGG + Intronic
1185302072 22:50087039-50087061 TGTCGTGGAAGGGGCCCGGTGGG + Intergenic
950666340 3:14497557-14497579 TGTGGTCTAGAGGGCGCCGCAGG - Intronic
954223963 3:49171183-49171205 TGGCCTCCAGGGGGCGCCGCCGG + Intergenic
954663672 3:52239163-52239185 TGTCGGGGGCGGGGCGCCGCTGG - Exonic
961389224 3:126542497-126542519 AGAGGTCGAAGAGGCGCCGCTGG - Exonic
963335734 3:143972053-143972075 TGGCGTGGAGGAGGCGCCGCCGG + Exonic
971073988 4:23127030-23127052 TGTGGTGGAAGGGGCCCAGCTGG + Intergenic
976921869 4:90452388-90452410 TGTCTTCTAAGGGGAGCCTCTGG - Intronic
986201194 5:5580304-5580326 TGTCGTGGGAGGGACGCCGTGGG + Intergenic
995566082 5:113434044-113434066 TCTCGTCGATGTGGAGCCGCCGG + Exonic
996290973 5:121852062-121852084 TGGGGTCCAAGGGGCGCCCCGGG - Exonic
1027188473 7:75985126-75985148 GGTGGTCGATGGGGGGCCGCAGG - Exonic
1049297790 8:141852374-141852396 TGTCTTCGAAGGGAGGCCACAGG + Intergenic
1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG + Exonic