ID: 1128322543

View in Genome Browser
Species Human (GRCh38)
Location 15:66703442-66703464
Sequence CGGGGCCGCCGCGGGGCTAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 5, 3: 21, 4: 236}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128322543_1128322558 13 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322558 15:66703478-66703500 CAGCGAGGCGCCCAGGGCGCGGG 0: 1
1: 0
2: 5
3: 21
4: 249
1128322543_1128322562 23 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322562 15:66703488-66703510 CCCAGGGCGCGGGGAGGCGCCGG 0: 1
1: 1
2: 8
3: 85
4: 647
1128322543_1128322557 12 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322557 15:66703477-66703499 ACAGCGAGGCGCCCAGGGCGCGG 0: 1
1: 0
2: 0
3: 13
4: 162
1128322543_1128322556 7 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322556 15:66703472-66703494 GTGGGACAGCGAGGCGCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 149
1128322543_1128322559 14 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322559 15:66703479-66703501 AGCGAGGCGCCCAGGGCGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 207
1128322543_1128322555 6 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322555 15:66703471-66703493 AGTGGGACAGCGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 129
1128322543_1128322554 -2 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322554 15:66703463-66703485 CGGGACGCAGTGGGACAGCGAGG 0: 1
1: 0
2: 0
3: 15
4: 135
1128322543_1128322560 17 Left 1128322543 15:66703442-66703464 CCGGTAGCCCCGCGGCGGCCCCG 0: 1
1: 1
2: 5
3: 21
4: 236
Right 1128322560 15:66703482-66703504 GAGGCGCCCAGGGCGCGGGGAGG 0: 1
1: 0
2: 6
3: 54
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128322543 Original CRISPR CGGGGCCGCCGCGGGGCTAC CGG (reversed) Exonic
900113586 1:1019705-1019727 CGGGACTGCCGAGGGGCTCCGGG - Intergenic
900244885 1:1632232-1632254 CGGGGCCTCCGAGGGGACACGGG - Exonic
900255060 1:1693532-1693554 CGGGGCTGCCGCGGGACATCCGG + Intronic
900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG + Intergenic
900284156 1:1891264-1891286 CCGGGCCGCCGGGGGTCTCCCGG - Intergenic
900364791 1:2306712-2306734 CGGGCCCGCCCCGAGGCTGCGGG + Exonic
900513371 1:3070438-3070460 CGGGGCTTCGGCGGGGCTGCGGG - Intronic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
902914025 1:19624993-19625015 CGGGGCTGCAGTGGGGCTAGTGG + Intronic
903142230 1:21345552-21345574 CGGGGCCGCCGCGGGGCCAATGG + Intergenic
903813132 1:26045915-26045937 CGGGGCGGCTGCGCGGCTGCCGG - Exonic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904055609 1:27668244-27668266 CGTGCCCGCCGGGGGGCTAGTGG - Exonic
904620592 1:31772854-31772876 CGGGGCCGTCTCTGGGCTCCGGG + Intergenic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
908401322 1:63774700-63774722 CCGGCCCGCCGCGGGGCTCCGGG - Intronic
910760829 1:90729637-90729659 AGGGGGCGCCGGGGCGCTACGGG + Intergenic
912381366 1:109249770-109249792 CAGGGGCGCCGCGGGGCCCCCGG + Intergenic
913222080 1:116667720-116667742 AGGGGCCGCAGCGCGGCTGCTGG - Exonic
913968104 1:143393386-143393408 TGGGGCCGCCGCGGGCCTTGAGG + Intergenic
914062485 1:144218976-144218998 TGGGGCCGCCGCGGGCCTTGAGG + Intergenic
914116665 1:144747378-144747400 TGGGGCCGCCGCGGGCCTTGAGG - Intergenic
914242028 1:145858788-145858810 AGGGGCTGCGGCGGGGCTCCGGG - Intronic
916694391 1:167221307-167221329 CGGGTCCGCGGCGGGGCGGCGGG + Intronic
919929946 1:202214504-202214526 CGGGGCCGCCGCTTAGCTCCCGG + Intronic
922775438 1:228212362-228212384 CAGCGCCGCCGCGGCGCTAGTGG + Exonic
923986387 1:239387031-239387053 CGGGGCCGCAGCAGCGCTTCTGG + Intronic
924527139 1:244863275-244863297 CGGCGCCACCGCGGGCCGACCGG + Intronic
1069424724 10:68279148-68279170 CCGGACCGCCGCGGGGCCATGGG + Intergenic
1071498711 10:86188644-86188666 CAGGGCTGCCCTGGGGCTACAGG + Intronic
1075031967 10:119029825-119029847 CGCGGCCGCGGCGGGGCGAGCGG - Exonic
1075144653 10:119872772-119872794 TGGGGCCGCCGAGGAGCTGCTGG + Intronic
1075802813 10:125162868-125162890 CGCGGCCACCGCCAGGCTACCGG + Intergenic
1076707094 10:132307991-132308013 CGGGGCAGGGGCGGGGCTTCTGG + Intronic
1077610898 11:3642519-3642541 CGGGACCCCCGCGGGGCCCCTGG - Intergenic
1077914709 11:6603750-6603772 CGGGGCCGGCGGCGGGCTGCGGG + Intronic
1078139672 11:8682959-8682981 CGGGCCCGGGGCGGGGCTCCCGG + Intronic
1078139854 11:8684013-8684035 CGCGGCCGCCGGGGTGCTTCCGG - Exonic
1078631925 11:13010692-13010714 CGGGGCCACCGTCGGGCTCCAGG - Intergenic
1079163350 11:18013695-18013717 CGGGGCAGCCTCGGCGCTCCGGG + Intergenic
1082807645 11:57460766-57460788 CGGGGACCCCGCGGGGCTCCGGG - Exonic
1083741439 11:64713594-64713616 CGGGGCCGCCGCCGAACTCCAGG + Exonic
1083940012 11:65890718-65890740 CGGGCCCGACGTGGGGCTCCTGG + Exonic
1084165584 11:67373422-67373444 CGGCCCCGGCGCGGGGCTCCCGG + Intronic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1086455323 11:86954972-86954994 TGGGGCCGGCGCGGGGCTTCGGG - Exonic
1088579204 11:111299569-111299591 AGGGGCCGCCCCGGGGCTGGCGG - Exonic
1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG + Intergenic
1090280398 11:125451486-125451508 AGGGGCCAGTGCGGGGCTACTGG - Intronic
1091286737 11:134412225-134412247 CGGTGCCGCCGCGGCTCTGCCGG + Intergenic
1091410247 12:234423-234445 CAGGGCAGCCCCAGGGCTACTGG - Intronic
1091474017 12:753879-753901 CGGGACAGCCGCGGGGATGCTGG - Exonic
1093547852 12:20369234-20369256 CGGGGGCGTCGGGGGGCCACTGG + Exonic
1094025873 12:25959054-25959076 CTGGGCGGCCGCGGAGCTCCGGG + Exonic
1095476178 12:42589502-42589524 CGGCGCCGCTGCGGGGCTGCTGG + Exonic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096788916 12:54033346-54033368 CGGAGCGGCCGCGGCGCTGCAGG - Exonic
1097891409 12:64780954-64780976 CGGAGCGGCCGCGGCGCTCCCGG + Intergenic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1103698688 12:122836053-122836075 CGGGGCCGGCGCGGCCCGACTGG + Intronic
1103781571 12:123402286-123402308 CGGGGCCGTGGCTGGGCTGCAGG + Intronic
1103822858 12:123712443-123712465 CGGGGCCGCGGCCAGGCCACAGG + Exonic
1104434355 12:128743817-128743839 CGGGGCCGCCCAAGGGCTAATGG - Intergenic
1104860646 12:131921645-131921667 CGGGGCTGCCCTGGGGCTAGAGG - Exonic
1104929257 12:132329484-132329506 CGGGGGCGCCGGGGGGCGGCGGG + Intergenic
1104949474 12:132432757-132432779 CGGAGCCGCCGGGGGCCTCCAGG - Intergenic
1104974099 12:132544370-132544392 CGGGGTCTCCTCGTGGCTACAGG + Intronic
1105293900 13:19071855-19071877 CGGGGCCGCTGCTGGGATCCAGG + Intergenic
1105782648 13:23717485-23717507 AGGGGCAGCTGCAGGGCTACAGG + Intergenic
1106683378 13:32031323-32031345 CACGGCCGCCGCGGGGCTAAGGG - Exonic
1108615587 13:52128973-52128995 CGGAGCCGCCACAGGGCTTCGGG - Intronic
1113994167 14:16053173-16053195 CGGGCCCGACGAGGGGCGACTGG + Intergenic
1115261303 14:31457158-31457180 CGGTCCGGCCGCGGGGATACCGG - Intronic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1116817855 14:49599766-49599788 CGGGGCCGGGGCGGGGATCCGGG + Intronic
1118607739 14:67515572-67515594 CGGGGCCGACCCCGGGCTGCGGG - Intronic
1118776953 14:68979190-68979212 CGGTTCCGCCGCGGCGCTGCTGG + Exonic
1118809217 14:69261213-69261235 GGGGGCGGCGGCGGGGCTGCGGG + Intronic
1119732814 14:76961857-76961879 TGGGGCCGCAGCGGGGCTTCCGG - Intergenic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122657919 14:103274182-103274204 CGGGGCTGCTGCGGGGCTGCTGG - Intergenic
1126467688 15:48975924-48975946 CGGGGCGGCCGCGGAGCTGGCGG - Intergenic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1128742939 15:70096127-70096149 GGGGGCCGCCCCGGGGCTGGCGG - Intronic
1128987451 15:72231446-72231468 TGGGGACGCGGCGGGGCAACGGG + Intronic
1129287967 15:74541145-74541167 CGGGGGCGGGGCGGGGCCACAGG - Intergenic
1130261205 15:82355494-82355516 CGGGGGCTGCGCGGGGCTTCAGG + Intergenic
1130280030 15:82513524-82513546 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130471405 15:84229710-84229732 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130478899 15:84344281-84344303 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130492871 15:84443850-84443872 CGGGGGCTGCGCGGGGCTTCAGG + Intergenic
1130593699 15:85234337-85234359 CGGGGGCTGCGCGGGGCTTCAGG - Intergenic
1130991597 15:88879054-88879076 CCGGGCCACCGCAGGGCTGCCGG + Exonic
1132560231 16:590142-590164 CGGGGCCGGCGCTGGGCTTCGGG + Intronic
1132683441 16:1153008-1153030 CGGGGCGGGCGGGGGGGTACTGG - Intergenic
1132719811 16:1309987-1310009 CCGGGCCGCCGCAGGCCTTCGGG + Intronic
1132935001 16:2475581-2475603 CGGGGCCGCTGCAGGTCCACAGG - Intronic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133298355 16:4766785-4766807 CGGGGCCGCGTAGGGGCTTCAGG - Intronic
1134134115 16:11668496-11668518 CGGGGCTGCTGCGGGGCGATCGG + Exonic
1135592255 16:23712999-23713021 CGAGGGCGCGGCGGGGCCACGGG - Intronic
1136923439 16:34350500-34350522 CGGGGGAGTCGCGGGGCTCCTGG - Intergenic
1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG + Intergenic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1137988486 16:53130532-53130554 GGCGGCCGCGGCGGGGCTGCCGG + Intronic
1138434511 16:56989626-56989648 CGGGCGTGCCGCGGGGCTGCGGG + Intronic
1139974787 16:70800945-70800967 CGGGGCCGCGCCGGGGCCAGGGG + Exonic
1140416105 16:74774827-74774849 CGGAACGGCCGCGGGGCTCCCGG - Intronic
1141054837 16:80804749-80804771 CGGGGCCCCCGGGGGGCGGCGGG + Intergenic
1141699028 16:85634017-85634039 CGGGGCTGCCGCTGGGCACCAGG - Exonic
1141777396 16:86133599-86133621 CGGGGCCGCTGCTGTGCTGCAGG - Intergenic
1141840130 16:86568577-86568599 CGGGGCCGCCGCGGCGCAGGCGG + Exonic
1142005976 16:87689802-87689824 CGGGGTGGCCGCGGGGCTGGTGG - Exonic
1142068582 16:88076677-88076699 CGGAGCCGGCGAGGGGCTCCTGG - Exonic
1142136344 16:88453553-88453575 CGGGGGCGCGGCGGGGCCGCGGG - Exonic
1142551839 17:745594-745616 CGGGGCTGGCACGGGGCTCCTGG - Exonic
1142596276 17:1031537-1031559 CGGGGGCGCTGCGGGGCTCGGGG - Intronic
1143590840 17:7885213-7885235 CCGGACCGCCGCGGGGCCACGGG - Intronic
1147629245 17:41919183-41919205 CGGGGCCGGGGCGGGGCCCCGGG + Intronic
1148332035 17:46818921-46818943 CCCGGACGCCGCGGGGCTTCGGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148861045 17:50604489-50604511 CGGGGCTGCCGAGAGGCTTCAGG + Intronic
1151574202 17:74943406-74943428 CAGGGTGGCCGCGGGGCTATAGG + Intronic
1152356514 17:79810171-79810193 CGGGGCCGCGGCCGGGCGAGCGG + Intergenic
1152357250 17:79813287-79813309 GGGGGCGGCCGCGGGGCGAGCGG - Intergenic
1152589278 17:81203460-81203482 TGGGGAGGCCGCGGGGCTGCGGG - Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152783687 17:82237393-82237415 CGGGGCCGCCGCGACCCTCCCGG + Exonic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1157260827 18:46174349-46174371 CAGGGCCGCGGCCTGGCTACTGG + Intronic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1160853543 19:1206035-1206057 CGGGGGCTCCACGGGGCTCCCGG - Intronic
1160927887 19:1555803-1555825 GGCGGCGGCCGCGGGGCTGCTGG + Exonic
1160930714 19:1568357-1568379 CGGGGCCGGGGCGGGGCCGCGGG - Intergenic
1160967884 19:1754493-1754515 CGGGAGCGCCGCGGGGCTGCTGG + Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162181417 19:8871583-8871605 CTGGGCCGCTGAGGGGCTGCAGG + Exonic
1162430534 19:10625688-10625710 AGGGGTCGGCCCGGGGCTACGGG - Intronic
1163782703 19:19258640-19258662 CCAGGCCGCCGCAGGGCTCCCGG + Exonic
1164835137 19:31350952-31350974 CAGGGCCGCCTCGGGGATAGTGG - Intergenic
1165065720 19:33226809-33226831 GGGGGCCGCGTCGGGGCCACCGG + Intergenic
1166298005 19:41898007-41898029 CGGGGCAGCCTCGGGGCTAAGGG + Intronic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1168144934 19:54415554-54415576 TGGGGGCGCCCCCGGGCTACCGG + Exonic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
924985188 2:264223-264245 TGGAGCCGCCGCGGGGCTCTGGG - Intronic
925609439 2:5691788-5691810 CAGGGCCGCCGCGGGGCTACCGG + Intergenic
929966840 2:46542822-46542844 CGGGGCCGGGGCGGGGATCCGGG + Exonic
930700613 2:54456047-54456069 CTGGGCGGCTGCGGGGCTCCGGG + Intergenic
931348716 2:61470479-61470501 CGCGGCCGCCGCGGCGCCTCGGG - Intronic
931614643 2:64144020-64144042 CGGGGCCGCCGAGGGGCGCGGGG - Intronic
932765212 2:74464972-74464994 CGGGGCCACGGCGGGGCTGGAGG + Exonic
933876294 2:86623939-86623961 TCGGGGAGCCGCGGGGCTACCGG + Intronic
938301121 2:130213696-130213718 CGGGGCCGGGGCGGGGATCCTGG - Intergenic
938397854 2:130963965-130963987 TGCGGCGGCCGCGGGGCTGCCGG - Intronic
938406323 2:131035103-131035125 CGGGGCCGCGCCGGGGCTGCGGG - Intronic
938455595 2:131460771-131460793 CGGGGCCGGGGCGGGGATCCTGG + Intergenic
938537487 2:132257697-132257719 CGGGCCCGACGAGGGGCGACTGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946966580 2:225042779-225042801 GGCGGCCGCCGAGGGGCTCCGGG + Intergenic
947611932 2:231530170-231530192 CAGGGGCGCCGGGGGGCTGCGGG - Intronic
948205978 2:236163241-236163263 CGGGGGCGCCCCGGGGCTCAGGG + Intergenic
948438066 2:237967226-237967248 CGGGGCCGCCTCGGGCCCGCCGG + Intronic
1168777721 20:462212-462234 CGGGGCTGCTGCGGGGTTCCGGG - Intronic
1170745721 20:19097432-19097454 TGGGGCCCCCGCTGGGCTGCAGG + Intergenic
1171866395 20:30489476-30489498 CGGGCCCGACGAGGGGCGACTGG - Intergenic
1172439588 20:34955986-34956008 CGGGGTCGGCGGGGAGCTACGGG + Intergenic
1173251602 20:41366689-41366711 CGGGGGCGGCGCGGCGCTGCAGG - Exonic
1173617908 20:44414704-44414726 CGGGGCAGCCAGGGGGCTGCTGG + Intronic
1174134931 20:48373040-48373062 CGGGTCCGCCGGGCGGCGACGGG - Intergenic
1175399655 20:58693100-58693122 CGGGGCCTCCGCGGGCCGCCCGG - Intronic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1179951585 21:44711602-44711624 AGGGGCGGCCGCGGGGCCCCCGG + Intergenic
1180037800 21:45258719-45258741 CTGGGCGGCCGCGGGGGGACTGG + Intergenic
1180313102 22:11254342-11254364 CGGGCCCGACGAGGGGCGACTGG - Intergenic
1180744414 22:18077980-18078002 CCGGGACGCCGCGCGGCTGCGGG + Exonic
1180950409 22:19718260-19718282 CGGGGGCGCGGCAGGGCTCCCGG + Intronic
1183383671 22:37503053-37503075 AGGGGCCACGGCGGGGCTTCAGG + Intronic
1183961306 22:41413494-41413516 GGGGGCAGCCGCGGGGCCTCGGG + Intergenic
1184176374 22:42791851-42791873 CGGGGCCCCCGCGGACCTGCTGG - Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1185153406 22:49179352-49179374 CGGGGCCGCCGAGGGCCTGGCGG - Intergenic
950683894 3:14602976-14602998 CAGGGCGGCCGCGGGGATGCGGG - Intergenic
953385237 3:42502513-42502535 CGGGGCCGCCGCGCAGGTATGGG - Intronic
954215255 3:49120975-49120997 CGGGCCCGCCCCGGAGCTGCGGG - Intergenic
956892335 3:73624842-73624864 CGGGGTCGCCGCCGGGCGGCCGG + Exonic
961536682 3:127575146-127575168 CGGCGCCCCCGCGTGGCTGCCGG - Intronic
962808893 3:138945765-138945787 CGGGGCCGCCGCGCCGCCGCCGG - Exonic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
968048110 3:195635346-195635368 GGGGGAGGCCGCGGGGCAACCGG - Intergenic
968099292 3:195954274-195954296 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968306501 3:197654575-197654597 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
968490102 4:885510-885532 TGGGGCCCCCGCAGGGCTGCTGG - Intronic
969240383 4:5893128-5893150 CGGGGCCGGGGCGGGGCCTCTGG + Intergenic
969540851 4:7787978-7788000 AGGGGCCGCTGTGGGGCTGCGGG - Intronic
970332935 4:15003478-15003500 TGGCGGCGCCGCGGGGCTGCAGG - Exonic
971355346 4:25890274-25890296 GTGGGCCGCCGAGGGGCTGCAGG + Intronic
975870691 4:78776094-78776116 CGGGGCGGCGGCGGCGCGACGGG + Intergenic
975883606 4:78939396-78939418 CGGGTCCGCCGCGGCGCTGGCGG - Exonic
977908146 4:102501132-102501154 CGGGGCCGCTTCGGGGCGCCGGG - Intergenic
982257756 4:153466728-153466750 CGGGGCAGTCGCGGGGCTTGGGG + Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
985743479 5:1633695-1633717 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
988578027 5:32444912-32444934 CCGCGCGGCCGCGGGGCGACGGG + Intergenic
988825195 5:34929309-34929331 CGGGGCCTCGGCGGGGCGAGAGG - Intergenic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
993502711 5:88680551-88680573 GGGGGCCCGCGCGGGGCTCCTGG + Intergenic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002792914 6:448802-448824 GGAGGCCCCCGCGAGGCTACAGG + Intergenic
1002897624 6:1388930-1388952 GGGGGCCGCCGCAGGGTTGCGGG - Intergenic
1003087110 6:3068884-3068906 CGGGGCGGCCGCGGGCTTCCCGG + Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1007680491 6:43629913-43629935 CGGGGCCACCGCGGTGCCTCCGG - Intronic
1011516983 6:88166037-88166059 CGGCGCCGGCGCCGGGCTGCTGG + Exonic
1013230583 6:108158051-108158073 CTGGACCCCCGCGGGGCTTCGGG - Intronic
1015220675 6:130801590-130801612 CCGGACCGCCGCGGGGCCACGGG + Intergenic
1017337809 6:153282637-153282659 CGCGGCCGCCGGGGTGCTTCCGG + Intergenic
1017719710 6:157236088-157236110 CGGCTCCGCCTGGGGGCTACCGG + Intergenic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1019349084 7:544756-544778 AGGGGCCTCCACGGGGCTTCAGG + Intergenic
1019395712 7:816707-816729 CGGGGCGGGCGCCGGGCTGCGGG + Intronic
1022363354 7:29684996-29685018 CGGGGCCGCCGCGGCGCCGCCGG + Intergenic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1025208586 7:57008045-57008067 GGGGGCCGCAGCCGGGCTGCAGG - Intergenic
1025663361 7:63568833-63568855 GGGGGCCGCAGCCGGGCTGCAGG + Intergenic
1029549914 7:101232281-101232303 CGTGGCCGGGGCGGGGCTACGGG + Exonic
1032011576 7:128351195-128351217 CGGGGGCGCAGCGGGGCCAGAGG + Exonic
1034342808 7:150368962-150368984 CGGGGCCACCGCGGGCCCGCGGG + Intronic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034983226 7:155491418-155491440 CGGGGCGGCAGAGGGGCTCCCGG + Intronic
1035612150 8:973811-973833 CCGGACCGCCGCGGGGCCACGGG - Intergenic
1037947797 8:22999968-22999990 CGGCGCCGCCGCGCTGCTGCTGG - Intronic
1040471420 8:47738235-47738257 CGGGGGCGCCCCGGGGCCGCGGG + Exonic
1041244959 8:55880505-55880527 CGGGCGCGCGGCGGGGATACTGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1047615411 8:126558523-126558545 CGGGGCGGGGGCGGGGCTCCCGG - Intergenic
1049109750 8:140635509-140635531 TGGCGCCGCCGAGGGGCTCCGGG + Exonic
1049396371 8:142402997-142403019 CGCGGCCCCCGCCGGGCTCCGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1056475368 9:86947089-86947111 CGGGGCCGTGGCGGGGCTGCAGG + Exonic
1056746782 9:89310520-89310542 CTGGCCCGTCGCGGGGCTCCTGG - Intergenic
1057313437 9:93955209-93955231 CGGGGCCCGCGCGGGGCTCTAGG + Exonic
1060355690 9:122905146-122905168 CCGCGCCGTCGCGGGGCTCCCGG - Intronic
1060700959 9:125748066-125748088 CGGGCCCGGCGCGGGGCGATGGG + Intronic
1060815367 9:126632417-126632439 AGGGGCTGCCGAGGGGCTGCTGG + Intronic
1061123116 9:128656476-128656498 CGGGGTCGCAGCGCGGCTGCCGG - Intronic
1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG + Intronic
1061807471 9:133144420-133144442 CGGGGCCGAGGCGGGGTGACTGG - Intronic
1062500421 9:136849691-136849713 CGGGGCGGGGGCGGGGCTGCGGG + Intronic
1062621234 9:137423376-137423398 AGGGGGCGCCGCGGGGCAGCGGG + Exonic
1185456158 X:311830-311852 CGGGGCCGCCGTGCGGACACGGG + Intronic
1185469418 X:373723-373745 CGGGGCCGGCGGGGCGCTGCAGG + Intronic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1189473546 X:41332938-41332960 AGGGGCTGCAGCGGGGTTACCGG - Intergenic
1195269396 X:103215349-103215371 CGGGCCCGCCGCGGGGCCCGGGG - Intronic
1200233678 X:154458356-154458378 CGGGGCCGCGGTGGGGCTCGGGG + Exonic
1201904639 Y:19076768-19076790 CGGGGCGGACGGGGGGCTCCGGG - Intergenic