ID: 1128323007

View in Genome Browser
Species Human (GRCh38)
Location 15:66705734-66705756
Sequence GGTGGGATTATGTTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128323007_1128323019 1 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323019 15:66705758-66705780 GGGATTTATGGGGGAGAGATGGG 0: 1
1: 0
2: 0
3: 29
4: 247
1128323007_1128323024 22 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323024 15:66705779-66705801 GGGGAAGAAGGGAAGTGTGCAGG 0: 1
1: 0
2: 3
3: 57
4: 640
1128323007_1128323020 2 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323020 15:66705759-66705781 GGATTTATGGGGGAGAGATGGGG 0: 1
1: 0
2: 0
3: 35
4: 336
1128323007_1128323013 -9 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323013 15:66705748-66705770 AATCCCACCAGGGATTTATGGGG 0: 1
1: 0
2: 2
3: 41
4: 347
1128323007_1128323023 11 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323023 15:66705768-66705790 GGGGAGAGATGGGGGAAGAAGGG 0: 1
1: 5
2: 21
3: 259
4: 2343
1128323007_1128323018 0 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323018 15:66705757-66705779 AGGGATTTATGGGGGAGAGATGG 0: 1
1: 0
2: 0
3: 41
4: 445
1128323007_1128323021 3 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323021 15:66705760-66705782 GATTTATGGGGGAGAGATGGGGG 0: 1
1: 0
2: 2
3: 23
4: 327
1128323007_1128323022 10 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323022 15:66705767-66705789 GGGGGAGAGATGGGGGAAGAAGG 0: 1
1: 3
2: 29
3: 323
4: 2338
1128323007_1128323025 23 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323025 15:66705780-66705802 GGGAAGAAGGGAAGTGTGCAGGG 0: 1
1: 0
2: 3
3: 94
4: 913
1128323007_1128323014 -8 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323014 15:66705749-66705771 ATCCCACCAGGGATTTATGGGGG 0: 1
1: 0
2: 2
3: 13
4: 124
1128323007_1128323012 -10 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323012 15:66705747-66705769 TAATCCCACCAGGGATTTATGGG 0: 1
1: 0
2: 1
3: 9
4: 118
1128323007_1128323026 28 Left 1128323007 15:66705734-66705756 CCCTCAAGAAACATAATCCCACC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1128323026 15:66705785-66705807 GAAGGGAAGTGTGCAGGGCCAGG 0: 1
1: 0
2: 5
3: 63
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128323007 Original CRISPR GGTGGGATTATGTTTCTTGA GGG (reversed) Intronic
902532823 1:17101414-17101436 GGTGGGATTAGGTTTCCTCAGGG + Intronic
908063312 1:60374948-60374970 GGTGAGATTATGTTTGATCATGG + Intergenic
909689268 1:78388588-78388610 GGTGTGGTTATCTTTCTTGAAGG + Intronic
909871440 1:80744101-80744123 GCAGGGATTATGTTTCTAGTGGG - Intergenic
910537563 1:88316200-88316222 GATGTAATTATTTTTCTTGATGG - Intergenic
914840314 1:151242853-151242875 GGTAGGATTCTGTTCCTTGTGGG + Intronic
916288546 1:163137811-163137833 GGAGGGATATTGTTTCCTGAGGG + Intronic
918392951 1:184085262-184085284 GTGGGGATTAGGTCTCTTGAAGG + Intergenic
919579347 1:199352105-199352127 GGTGGGAGTAAGTTTTATGATGG - Intergenic
1063519375 10:6727024-6727046 GGTGGGATAATTGTTCTTGATGG + Intergenic
1064798610 10:19042435-19042457 GGTGGAATTATGTTTCCATAGGG - Intergenic
1064894015 10:20213258-20213280 CGTGGGGTTTTTTTTCTTGATGG + Intronic
1065655152 10:27941022-27941044 GGTGGGCTTACATTTCTTGTGGG - Intronic
1069874144 10:71551405-71551427 GGTGGGACTCTGTTTCTAGGTGG + Intronic
1070326033 10:75389800-75389822 GGTTGGATTTTGTTTCTTTCAGG + Intergenic
1071214814 10:83388452-83388474 GATGAGATTATGTCTTTTGAGGG - Intergenic
1072629807 10:97137800-97137822 GGTTGCTTAATGTTTCTTGATGG + Intronic
1073535288 10:104270882-104270904 GGTGGCATTATTTTCCTAGAAGG + Intronic
1074092244 10:110272005-110272027 GCTGGGATTATGTCTCTCAAAGG - Intronic
1074111940 10:110429010-110429032 GGTGGAATTCTGTTTCCTAAAGG - Intergenic
1074573258 10:114644496-114644518 GGTGTAATGATCTTTCTTGACGG + Intronic
1076877153 10:133221494-133221516 GGTGGGAGATTGTGTCTTGAGGG - Intronic
1078928842 11:15897881-15897903 GGTGGGATTCAGTTCCTTGCTGG - Intergenic
1079840732 11:25396104-25396126 GCTCAAATTATGTTTCTTGAGGG + Intergenic
1085143649 11:74172113-74172135 GGTGAGATTAGGTCTCTTAAGGG + Intronic
1085542088 11:77281069-77281091 GGTGTGATTATGCTGCTAGAGGG - Intronic
1086041982 11:82490339-82490361 GGTGGGATTATGTTTTTGACTGG + Intergenic
1086265973 11:84998593-84998615 GGTGGTATCATGGTTGTTGATGG + Intronic
1088511674 11:110582043-110582065 TGTGGTATGATGTTTTTTGATGG - Intronic
1088621021 11:111683827-111683849 GCTTGGATTGTGTTCCTTGAAGG + Intronic
1089310220 11:117553048-117553070 GATGAGATCAAGTTTCTTGAGGG + Intronic
1090729755 11:129559644-129559666 GTTGGAATTTTGTTTCTTTAAGG - Intergenic
1091132936 11:133161759-133161781 CGTAGAATTGTGTTTCTTGAGGG - Intronic
1092085136 12:5750866-5750888 GGAGTGATTGTGTTTCTTTATGG - Exonic
1092165468 12:6339974-6339996 GGTGGGATTATGTCTCCTAAGGG - Intronic
1094304800 12:29006684-29006706 GGTGGGATTCTGTTGCTTTGGGG - Intergenic
1096769155 12:53922592-53922614 CGAGGCATTATGTTGCTTGAAGG + Intergenic
1098652670 12:72992751-72992773 TGTGAGATTGTGTTTATTGAGGG + Intergenic
1099355867 12:81634605-81634627 AGTGGAATAATTTTTCTTGAAGG + Intronic
1100846369 12:98662384-98662406 GGTGGGATTATCTTTTTAAAAGG + Intronic
1102431515 12:112887859-112887881 GTTGGGCTTCAGTTTCTTGAGGG - Exonic
1103128056 12:118441811-118441833 GGTGTGATTATTTTCCTGGAGGG + Intergenic
1104429311 12:128703982-128704004 TGTGGGATTATGTTTGCTGTGGG + Intronic
1105817937 13:24053584-24053606 GGTGGGAGTATTTTTCTCTATGG + Intronic
1106910527 13:34458390-34458412 GGCGGGATTCAGTTCCTTGAAGG - Intergenic
1110916124 13:81022909-81022931 GCTGGAATTATTTTTCTTTAAGG - Intergenic
1111040261 13:82739072-82739094 GTTGGGATTTTATTTCTTTAGGG + Intergenic
1111042847 13:82772935-82772957 TGTGTGAATGTGTTTCTTGAGGG - Intergenic
1111573971 13:90126282-90126304 TGTGGCATTATATTTATTGAGGG + Intergenic
1112649563 13:101379544-101379566 GATGAGTTCATGTTTCTTGAAGG + Intronic
1115978575 14:39023630-39023652 GGTGGGATCAAGTTTCCTAAGGG - Intergenic
1118465370 14:66025790-66025812 CATTGAATTATGTTTCTTGATGG - Intergenic
1118571718 14:67200915-67200937 GGTGGGGTTGTGCATCTTGAAGG - Intronic
1119058041 14:71443628-71443650 GATGGAATTATTTTTCATGATGG + Intronic
1121395584 14:93619768-93619790 GGTGCGATTATGATTATTCAAGG - Intronic
1121403119 14:93699634-93699656 GGTGGTATAATATTCCTTGAAGG - Intronic
1127809957 15:62557137-62557159 GGTGGTCTTATTTTTCTTCAAGG + Intronic
1128323007 15:66705734-66705756 GGTGGGATTATGTTTCTTGAGGG - Intronic
1128630108 15:69256320-69256342 GGTGTGTTTATGTCTTTTGAAGG + Exonic
1129189737 15:73930350-73930372 GGTGGGAGTGTGTTTTTTGCTGG + Intronic
1131057051 15:89381234-89381256 GGGAGGGTTATGCTTCTTGATGG + Intergenic
1131433984 15:92408513-92408535 GGAGGGAGTAAGTTCCTTGAGGG + Intronic
1131498610 15:92937452-92937474 TGTCGGATTATTTATCTTGAAGG + Intronic
1131907594 15:97160537-97160559 GTTGGTATGATGTTTCTTCATGG + Intergenic
1132064929 15:98722928-98722950 GGTGGGATTCTTCCTCTTGAAGG + Intronic
1135675686 16:24413064-24413086 GGTAGGATTTTCTTTCCTGATGG + Intergenic
1138113782 16:54344420-54344442 GGTGTGATCAGGTTTCTTTACGG + Intergenic
1140140426 16:72251569-72251591 GCTTGGATTATATTTCTAGATGG - Intergenic
1144733613 17:17542587-17542609 GGTGGGATTGTCTTTCATGGAGG + Intronic
1145860461 17:28205602-28205624 GGTTGTTTTTTGTTTCTTGATGG + Intergenic
1147729728 17:42590990-42591012 GTTGGGATTAGGTTTTTTGTTGG - Intronic
1149604764 17:57916820-57916842 GGTGGGATTTTGCTGCTTGAAGG - Intronic
1151011359 17:70501337-70501359 GGAGGGTCTATATTTCTTGAAGG - Intergenic
1154959924 18:21297903-21297925 GGTGGGATCATCTGACTTGAGGG + Intronic
1155383476 18:25250223-25250245 TGTGAGATTATGTAACTTGAAGG - Intronic
1156439835 18:37173628-37173650 GCTTGGTTTATGTTTCTTCAGGG + Intronic
1156488588 18:37482762-37482784 AATGGGATTATTTTTCTTGCTGG + Intronic
1156509758 18:37626545-37626567 GGGGGGATTAAGTTTGTTGATGG - Intergenic
1156729747 18:40177479-40177501 AGTTGGACTATGTTTCTTAAAGG + Intergenic
1157342682 18:46793508-46793530 TTTGGGATGATGTTTCTGGAAGG - Intergenic
1157598473 18:48878226-48878248 GGAGGGATTGTGTTCCTGGAAGG - Intergenic
1157809098 18:50680536-50680558 GATGGGATGATGTTTCTTTTGGG - Intronic
1158371896 18:56816217-56816239 GGTGGGATTAAGTATTTCGACGG + Intronic
930069267 2:47352822-47352844 GGTGTGATTATGGTTCATGGCGG + Intronic
930887456 2:56343092-56343114 AGTGTGATTATGTTCCATGATGG + Intronic
934017856 2:87908404-87908426 GGAGAGGTTATGTCTCTTGACGG - Intergenic
942406170 2:175658338-175658360 GTTGGAAATGTGTTTCTTGATGG + Intergenic
943125539 2:183791115-183791137 GGTGAGATTATATTTCATTATGG + Intergenic
943333313 2:186586225-186586247 GGTTTGATTATGGTTATTGAAGG + Intergenic
947125249 2:226862258-226862280 GGAGGTTTTATGTTTCTTAAAGG + Intronic
1172141796 20:32727748-32727770 GGTGGGACTCTGTCTCTGGAGGG - Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1182533582 22:30982259-30982281 GGGGGGATTATGTTGAGTGAAGG + Intergenic
951348640 3:21577711-21577733 GGTGGGATTATATTTCATTGTGG + Intronic
951918600 3:27828356-27828378 GGAGGGAAAATGTTTGTTGAAGG + Intergenic
952686579 3:36156672-36156694 GGTGGTATAATGTTATTTGAAGG + Intergenic
953461727 3:43086755-43086777 GCTGGGCTTATGTTTATTGCTGG - Intronic
954004991 3:47583583-47583605 GGTGGGATTATCTCCCCTGAAGG + Intergenic
954903566 3:54041112-54041134 GGTGGGATTTGGTTTCTTCTGGG + Intergenic
958745907 3:98134104-98134126 GGGTGAATTCTGTTTCTTGAAGG + Intergenic
962841148 3:139233781-139233803 TGCGGGATTAAGTTTCTTTAAGG - Intronic
963493299 3:146028492-146028514 GGTAGGATTAACTTTCTTAATGG + Intergenic
963724270 3:148901948-148901970 GGTGGGTTAATGTTTTTTGAGGG - Intergenic
975820516 4:78266340-78266362 GGTGGGATTTTGTTTCATGTGGG + Intronic
976214985 4:82707719-82707741 GGTAGGATTTGGTTCCTTGAGGG - Intronic
976655229 4:87481511-87481533 GGTGGGAGCATGTTTCAGGAGGG - Intronic
977447185 4:97145547-97145569 GGCGGGATTCAGTTTCTTGTTGG - Intergenic
978103454 4:104872354-104872376 GGTAATATTATGTTTCTTCATGG - Intergenic
979792315 4:124800606-124800628 GGTGGGATTATGTTCCTGGGAGG - Intergenic
979878214 4:125920605-125920627 AGTGACAATATGTTTCTTGAAGG - Intergenic
981217256 4:142184968-142184990 GTTGGAATTATATTTCTTAAAGG - Intronic
981991286 4:150924086-150924108 GGAGGAATGATGTTTCTAGATGG - Intronic
983297225 4:165881342-165881364 GGAGGGATAATGTTAATTGATGG - Intronic
991495356 5:67220555-67220577 GCTGGGATAATGTTCCTTGCTGG + Intergenic
992067877 5:73123889-73123911 TGTGGGATTGTGTTTCTTCGTGG + Exonic
992068958 5:73132069-73132091 GGTGAGATTATTTTTATTGGTGG + Intergenic
992319576 5:75599559-75599581 TGTAGTATTATGGTTCTTGATGG + Exonic
992610073 5:78500111-78500133 GATGGCATTATTTTTCTGGATGG - Intronic
996844372 5:127883221-127883243 GGTGGGATAATGATTCCTGTGGG - Intergenic
998977960 5:147668974-147668996 AGTGGGATTATTTGTCTTGCTGG + Intronic
999655850 5:153809942-153809964 GGTGGGGTTTGGTTTCTTGGTGG - Intronic
1000913263 5:167047794-167047816 TGTGTGATGATGTTTCTTGTAGG + Intergenic
1000921317 5:167141309-167141331 GATGGTATTATCTTTCTTGATGG + Intergenic
1005102203 6:22183998-22184020 GGTGAGATTGAGTTTCTTGTTGG + Intergenic
1005282060 6:24284683-24284705 GTTTGGATTTTATTTCTTGATGG - Intronic
1006047105 6:31307736-31307758 GCTGGAATTATGTTCCTTGGAGG - Intronic
1006660835 6:35642618-35642640 GGGTGGATAATGTTTATTGATGG - Intronic
1006885321 6:37376904-37376926 GGTAGGATTGTGTGTCTTGCAGG + Exonic
1007165416 6:39825449-39825471 GGGGGGCCTTTGTTTCTTGAAGG + Intronic
1008159068 6:48055145-48055167 GGGTGGATCCTGTTTCTTGATGG - Intronic
1008185055 6:48378571-48378593 TGTGGCATTAACTTTCTTGATGG - Intergenic
1009890291 6:69672435-69672457 AGAGGGATTATATATCTTGAAGG - Intergenic
1011550883 6:88530240-88530262 GGTGGGATTATTCTTCTTATGGG - Intergenic
1012264072 6:97119970-97119992 GGAGGGATTTTGTTTGTTTAAGG + Intronic
1012690996 6:102310638-102310660 GGTAGGCTTATCTTTCATGATGG - Intergenic
1012701071 6:102458466-102458488 GGTGGGCTTCTGCTTCTTCAGGG + Intergenic
1012892481 6:104912098-104912120 GGTGGAAGTGTGTTTCTTGTAGG - Intergenic
1014608312 6:123506754-123506776 GCTGGGATTAAATTTCTTCATGG + Intronic
1014789877 6:125660099-125660121 GGTAGGATTTTGGTTCTTAAGGG + Intergenic
1034879575 7:154752988-154753010 GCTGGGGTTGTGTTTCTTGGGGG + Intronic
1037694989 8:21215754-21215776 GTTGGGATTCTGTTTCTACATGG + Intergenic
1037909926 8:22738264-22738286 TGTGGGATCATGTGTCTTCAAGG - Intronic
1041125874 8:54637911-54637933 GGGGACATTATTTTTCTTGAAGG + Intergenic
1044431769 8:92115693-92115715 GGTGAGATTATATTTCATTATGG + Intergenic
1044459751 8:92430100-92430122 GGTGATATGATGTGTCTTGAAGG - Intergenic
1047935295 8:129770518-129770540 GGGGGGATTAATTTTTTTGAGGG - Intronic
1050655406 9:7823201-7823223 GAGGGGATTATGGATCTTGAAGG - Intronic
1050979043 9:11985110-11985132 ACTTGGATTATGTTTCTAGATGG + Intergenic
1051448696 9:17171194-17171216 GGTGGCATTTTGTTTTTTGGTGG + Intronic
1051977705 9:22972607-22972629 AGTAGGATTATGGTTTTTGAAGG + Intergenic
1057136937 9:92697808-92697830 GTTGGAATTTTGTTTCTTTAAGG + Intergenic
1060315773 9:122509146-122509168 GGTGGGATTAAGGTTGTAGATGG - Intergenic
1186202872 X:7171573-7171595 GGTGCAATTGTGTTTGTTGATGG - Intergenic
1189897293 X:45668763-45668785 AGGGGGATTTTGTGTCTTGAAGG - Intergenic
1192625010 X:72717342-72717364 GAAGGCATTATGTTTCATGAAGG + Intergenic
1193902820 X:87203887-87203909 GGTGGGATTGTCTGTCTTCAGGG - Intergenic
1195490729 X:105466399-105466421 ACTGGGATTATGTTTCAGGATGG + Intronic
1195490736 X:105466551-105466573 GATGTGATCATCTTTCTTGAAGG - Intronic
1197287759 X:124615868-124615890 GGTATTATTATGTTTCTTTAGGG + Intronic
1199126676 X:144130605-144130627 GGAGAGGTTATGTCTCTTGACGG + Intergenic
1199735233 X:150679887-150679909 AGTGGGATTCTCTTTCTAGAGGG + Intergenic
1201017166 Y:9617227-9617249 GAAGGGCTTCTGTTTCTTGAAGG + Intergenic