ID: 1128336289

View in Genome Browser
Species Human (GRCh38)
Location 15:66787654-66787676
Sequence GTTAGCACCCTGCCCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128336289_1128336294 7 Left 1128336289 15:66787654-66787676 CCCAGAGAGGGCAGGGTGCTAAC No data
Right 1128336294 15:66787684-66787706 ACACAGCAAGGCAGTAGCAAAGG No data
1128336289_1128336293 -5 Left 1128336289 15:66787654-66787676 CCCAGAGAGGGCAGGGTGCTAAC No data
Right 1128336293 15:66787672-66787694 CTAACTAGGGTCACACAGCAAGG No data
1128336289_1128336296 11 Left 1128336289 15:66787654-66787676 CCCAGAGAGGGCAGGGTGCTAAC No data
Right 1128336296 15:66787688-66787710 AGCAAGGCAGTAGCAAAGGGAGG No data
1128336289_1128336295 8 Left 1128336289 15:66787654-66787676 CCCAGAGAGGGCAGGGTGCTAAC No data
Right 1128336295 15:66787685-66787707 CACAGCAAGGCAGTAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128336289 Original CRISPR GTTAGCACCCTGCCCTCTCT GGG (reversed) Intergenic
No off target data available for this crispr