ID: 1128343999

View in Genome Browser
Species Human (GRCh38)
Location 15:66842469-66842491
Sequence GGTGGATGACACAGGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128343991_1128343999 5 Left 1128343991 15:66842441-66842463 CCCCGCGGAGGGGAAAACAGAAA No data
Right 1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG No data
1128343990_1128343999 9 Left 1128343990 15:66842437-66842459 CCAGCCCCGCGGAGGGGAAAACA No data
Right 1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG No data
1128343992_1128343999 4 Left 1128343992 15:66842442-66842464 CCCGCGGAGGGGAAAACAGAAAT No data
Right 1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG No data
1128343993_1128343999 3 Left 1128343993 15:66842443-66842465 CCGCGGAGGGGAAAACAGAAATT No data
Right 1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG No data
1128343985_1128343999 29 Left 1128343985 15:66842417-66842439 CCTAATTATTGTTTTTTCTTCCA No data
Right 1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128343999 Original CRISPR GGTGGATGACACAGGCCCGG CGG Intergenic
No off target data available for this crispr