ID: 1128345534

View in Genome Browser
Species Human (GRCh38)
Location 15:66850386-66850408
Sequence GCCTATCTTCAGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128345523_1128345534 6 Left 1128345523 15:66850357-66850379 CCCGCCGTCACTGGGACCACCTC No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345526_1128345534 -10 Left 1128345526 15:66850373-66850395 CCACCTCCCTTGAGCCTATCTTC No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345516_1128345534 19 Left 1128345516 15:66850344-66850366 CCCCCGCCAAGAGCCCGCCGTCA No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345525_1128345534 2 Left 1128345525 15:66850361-66850383 CCGTCACTGGGACCACCTCCCTT No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345518_1128345534 17 Left 1128345518 15:66850346-66850368 CCCGCCAAGAGCCCGCCGTCACT No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345524_1128345534 5 Left 1128345524 15:66850358-66850380 CCGCCGTCACTGGGACCACCTCC No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345519_1128345534 16 Left 1128345519 15:66850347-66850369 CCGCCAAGAGCCCGCCGTCACTG No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345522_1128345534 13 Left 1128345522 15:66850350-66850372 CCAAGAGCCCGCCGTCACTGGGA No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data
1128345517_1128345534 18 Left 1128345517 15:66850345-66850367 CCCCGCCAAGAGCCCGCCGTCAC No data
Right 1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128345534 Original CRISPR GCCTATCTTCAGAAGGGGGA TGG Intergenic
No off target data available for this crispr