ID: 1128346892

View in Genome Browser
Species Human (GRCh38)
Location 15:66859735-66859757
Sequence CCTCAGGGTCACCCTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128346892_1128346899 15 Left 1128346892 15:66859735-66859757 CCATGAACAGGGTGACCCTGAGG No data
Right 1128346899 15:66859773-66859795 CACAGCCCAAGTCAGAACCTTGG No data
1128346892_1128346900 19 Left 1128346892 15:66859735-66859757 CCATGAACAGGGTGACCCTGAGG No data
Right 1128346900 15:66859777-66859799 GCCCAAGTCAGAACCTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128346892 Original CRISPR CCTCAGGGTCACCCTGTTCA TGG (reversed) Intergenic
No off target data available for this crispr