ID: 1128352728

View in Genome Browser
Species Human (GRCh38)
Location 15:66901875-66901897
Sequence CTTGAGCTGCAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128352728_1128352730 3 Left 1128352728 15:66901875-66901897 CCTGCTTCCTTCTGCAGCTCAAG No data
Right 1128352730 15:66901901-66901923 CATTCATATGAAATGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128352728 Original CRISPR CTTGAGCTGCAGAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr