ID: 1128352733

View in Genome Browser
Species Human (GRCh38)
Location 15:66901932-66901954
Sequence GCTGGGTTGCTGTGCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128352733_1128352747 26 Left 1128352733 15:66901932-66901954 CCAGCTCAGCACAGCAACCCAGC No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data
1128352733_1128352737 -7 Left 1128352733 15:66901932-66901954 CCAGCTCAGCACAGCAACCCAGC No data
Right 1128352737 15:66901948-66901970 ACCCAGCTTCCCTGGGTGGCAGG No data
1128352733_1128352743 9 Left 1128352733 15:66901932-66901954 CCAGCTCAGCACAGCAACCCAGC No data
Right 1128352743 15:66901964-66901986 TGGCAGGGCTGCTTCCCCAGAGG No data
1128352733_1128352739 -6 Left 1128352733 15:66901932-66901954 CCAGCTCAGCACAGCAACCCAGC No data
Right 1128352739 15:66901949-66901971 CCCAGCTTCCCTGGGTGGCAGGG No data
1128352733_1128352748 27 Left 1128352733 15:66901932-66901954 CCAGCTCAGCACAGCAACCCAGC No data
Right 1128352748 15:66901982-66902004 AGAGGTGCCATGTGTCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128352733 Original CRISPR GCTGGGTTGCTGTGCTGAGC TGG (reversed) Intergenic
No off target data available for this crispr