ID: 1128352742

View in Genome Browser
Species Human (GRCh38)
Location 15:66901958-66901980
Sequence GGGAAGCAGCCCTGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128352742_1128352751 16 Left 1128352742 15:66901958-66901980 CCTGGGTGGCAGGGCTGCTTCCC No data
Right 1128352751 15:66901997-66902019 CTGATGGGCACCATGACAGTGGG No data
1128352742_1128352750 15 Left 1128352742 15:66901958-66901980 CCTGGGTGGCAGGGCTGCTTCCC No data
Right 1128352750 15:66901996-66902018 TCTGATGGGCACCATGACAGTGG No data
1128352742_1128352747 0 Left 1128352742 15:66901958-66901980 CCTGGGTGGCAGGGCTGCTTCCC No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data
1128352742_1128352752 21 Left 1128352742 15:66901958-66901980 CCTGGGTGGCAGGGCTGCTTCCC No data
Right 1128352752 15:66902002-66902024 GGGCACCATGACAGTGGGTCTGG No data
1128352742_1128352748 1 Left 1128352742 15:66901958-66901980 CCTGGGTGGCAGGGCTGCTTCCC No data
Right 1128352748 15:66901982-66902004 AGAGGTGCCATGTGTCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128352742 Original CRISPR GGGAAGCAGCCCTGCCACCC AGG (reversed) Intergenic
No off target data available for this crispr