ID: 1128352747

View in Genome Browser
Species Human (GRCh38)
Location 15:66901981-66902003
Sequence CAGAGGTGCCATGTGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128352742_1128352747 0 Left 1128352742 15:66901958-66901980 CCTGGGTGGCAGGGCTGCTTCCC No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data
1128352741_1128352747 1 Left 1128352741 15:66901957-66901979 CCCTGGGTGGCAGGGCTGCTTCC No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data
1128352740_1128352747 8 Left 1128352740 15:66901950-66901972 CCAGCTTCCCTGGGTGGCAGGGC No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data
1128352733_1128352747 26 Left 1128352733 15:66901932-66901954 CCAGCTCAGCACAGCAACCCAGC No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data
1128352738_1128352747 9 Left 1128352738 15:66901949-66901971 CCCAGCTTCCCTGGGTGGCAGGG No data
Right 1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128352747 Original CRISPR CAGAGGTGCCATGTGTCTGA TGG Intergenic
No off target data available for this crispr