ID: 1128353267

View in Genome Browser
Species Human (GRCh38)
Location 15:66906212-66906234
Sequence ATCCTTCCTCTGCTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128353263_1128353267 27 Left 1128353263 15:66906162-66906184 CCTGGTACAGAGGAAAGTGCAGC No data
Right 1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128353267 Original CRISPR ATCCTTCCTCTGCTACTTAC TGG Intergenic
No off target data available for this crispr