ID: 1128354001

View in Genome Browser
Species Human (GRCh38)
Location 15:66911656-66911678
Sequence CCTCACTCACTGCAGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128354001_1128354018 17 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354018 15:66911696-66911718 CTGGAGCCGCTGGGGGCCTGGGG No data
1128354001_1128354015 10 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354015 15:66911689-66911711 CTCGAAGCTGGAGCCGCTGGGGG No data
1128354001_1128354014 9 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354014 15:66911688-66911710 GCTCGAAGCTGGAGCCGCTGGGG No data
1128354001_1128354012 7 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354012 15:66911686-66911708 AGGCTCGAAGCTGGAGCCGCTGG No data
1128354001_1128354013 8 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354013 15:66911687-66911709 GGCTCGAAGCTGGAGCCGCTGGG No data
1128354001_1128354019 18 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354019 15:66911697-66911719 TGGAGCCGCTGGGGGCCTGGGGG No data
1128354001_1128354017 16 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354017 15:66911695-66911717 GCTGGAGCCGCTGGGGGCCTGGG No data
1128354001_1128354016 15 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354016 15:66911694-66911716 AGCTGGAGCCGCTGGGGGCCTGG No data
1128354001_1128354008 -2 Left 1128354001 15:66911656-66911678 CCCTAGACCTGCAGTGAGTGAGG No data
Right 1128354008 15:66911677-66911699 GGGCCCCGGAGGCTCGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128354001 Original CRISPR CCTCACTCACTGCAGGTCTA GGG (reversed) Intergenic
No off target data available for this crispr