ID: 1128355730

View in Genome Browser
Species Human (GRCh38)
Location 15:66925173-66925195
Sequence ATGAATTCACAGATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128355727_1128355730 -8 Left 1128355727 15:66925158-66925180 CCAGTAGGGAAGGCCATGAATTC No data
Right 1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG No data
1128355721_1128355730 28 Left 1128355721 15:66925122-66925144 CCAAGAAAGGGGAGGGCAGGTCA No data
Right 1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128355730 Original CRISPR ATGAATTCACAGATGGAGCC TGG Intergenic
No off target data available for this crispr