ID: 1128358229

View in Genome Browser
Species Human (GRCh38)
Location 15:66943298-66943320
Sequence CAGGCGCCTGTCTCTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358229_1128358235 2 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358235 15:66943323-66943345 CCCCCAGCAGGGCCAGCTCTGGG No data
1128358229_1128358231 -9 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358231 15:66943312-66943334 AGGCGCCTGAACCCCCAGCAGGG No data
1128358229_1128358246 16 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358246 15:66943337-66943359 AGCTCTGGGGGGCAGGGAAAGGG No data
1128358229_1128358239 4 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358239 15:66943325-66943347 CCCAGCAGGGCCAGCTCTGGGGG No data
1128358229_1128358237 3 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358237 15:66943324-66943346 CCCCAGCAGGGCCAGCTCTGGGG No data
1128358229_1128358233 1 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358233 15:66943322-66943344 ACCCCCAGCAGGGCCAGCTCTGG No data
1128358229_1128358245 15 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358245 15:66943336-66943358 CAGCTCTGGGGGGCAGGGAAAGG No data
1128358229_1128358242 9 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358242 15:66943330-66943352 CAGGGCCAGCTCTGGGGGGCAGG No data
1128358229_1128358241 5 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358241 15:66943326-66943348 CCAGCAGGGCCAGCTCTGGGGGG No data
1128358229_1128358230 -10 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358230 15:66943311-66943333 CAGGCGCCTGAACCCCCAGCAGG No data
1128358229_1128358243 10 Left 1128358229 15:66943298-66943320 CCTGCTCTAGAGACAGGCGCCTG No data
Right 1128358243 15:66943331-66943353 AGGGCCAGCTCTGGGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358229 Original CRISPR CAGGCGCCTGTCTCTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr