ID: 1128358467

View in Genome Browser
Species Human (GRCh38)
Location 15:66944306-66944328
Sequence CAGGTGCCTCCACAGGGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358456_1128358467 2 Left 1128358456 15:66944281-66944303 CCATCAACAACCCCCCGGCTACC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358455_1128358467 3 Left 1128358455 15:66944280-66944302 CCCATCAACAACCCCCCGGCTAC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358459_1128358467 -9 Left 1128358459 15:66944292-66944314 CCCCCGGCTACCACCAGGTGCCT No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358454_1128358467 6 Left 1128358454 15:66944277-66944299 CCACCCATCAACAACCCCCCGGC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358450_1128358467 29 Left 1128358450 15:66944254-66944276 CCTGTTTCTGACTGCTGACCCTA No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358451_1128358467 11 Left 1128358451 15:66944272-66944294 CCCTACCACCCATCAACAACCCC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358458_1128358467 -8 Left 1128358458 15:66944291-66944313 CCCCCCGGCTACCACCAGGTGCC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358452_1128358467 10 Left 1128358452 15:66944273-66944295 CCTACCACCCATCAACAACCCCC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data
1128358460_1128358467 -10 Left 1128358460 15:66944293-66944315 CCCCGGCTACCACCAGGTGCCTC No data
Right 1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358467 Original CRISPR CAGGTGCCTCCACAGGGTCG CGG Intergenic
No off target data available for this crispr