ID: 1128358870

View in Genome Browser
Species Human (GRCh38)
Location 15:66946622-66946644
Sequence ATGAAGTAAGCTGTGAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358870_1128358883 30 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358883 15:66946675-66946697 CAGGGCAGTTCCCAGCGGCAGGG No data
1128358870_1128358882 29 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358882 15:66946674-66946696 TCAGGGCAGTTCCCAGCGGCAGG No data
1128358870_1128358871 -4 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358871 15:66946641-66946663 TCATGTCCAGAGAACCTACAAGG No data
1128358870_1128358872 -3 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358872 15:66946642-66946664 CATGTCCAGAGAACCTACAAGGG No data
1128358870_1128358873 -2 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358873 15:66946643-66946665 ATGTCCAGAGAACCTACAAGGGG No data
1128358870_1128358876 11 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358876 15:66946656-66946678 CTACAAGGGGTATACCCCTCAGG No data
1128358870_1128358879 25 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358879 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
1128358870_1128358877 12 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358877 15:66946657-66946679 TACAAGGGGTATACCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358870 Original CRISPR ATGAAGTAAGCTGTGAGCCA CGG (reversed) Intergenic
No off target data available for this crispr