ID: 1128358874

View in Genome Browser
Species Human (GRCh38)
Location 15:66946647-66946669
Sequence TATACCCCTTGTAGGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358874_1128358888 22 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data
1128358874_1128358882 4 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358882 15:66946674-66946696 TCAGGGCAGTTCCCAGCGGCAGG No data
1128358874_1128358886 15 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358886 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
1128358874_1128358884 14 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358884 15:66946684-66946706 TCCCAGCGGCAGGGCCAGAAAGG No data
1128358874_1128358890 30 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358890 15:66946700-66946722 AGAAAGGGATTCTGGAACTCTGG No data
1128358874_1128358879 0 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358879 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
1128358874_1128358883 5 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358883 15:66946675-66946697 CAGGGCAGTTCCCAGCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358874 Original CRISPR TATACCCCTTGTAGGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr