ID: 1128358875

View in Genome Browser
Species Human (GRCh38)
Location 15:66946655-66946677
Sequence CTGAGGGGTATACCCCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358875_1128358886 7 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358886 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
1128358875_1128358882 -4 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358882 15:66946674-66946696 TCAGGGCAGTTCCCAGCGGCAGG No data
1128358875_1128358891 25 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG No data
1128358875_1128358879 -8 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358879 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
1128358875_1128358883 -3 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358883 15:66946675-66946697 CAGGGCAGTTCCCAGCGGCAGGG No data
1128358875_1128358884 6 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358884 15:66946684-66946706 TCCCAGCGGCAGGGCCAGAAAGG No data
1128358875_1128358890 22 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358890 15:66946700-66946722 AGAAAGGGATTCTGGAACTCTGG No data
1128358875_1128358888 14 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358875 Original CRISPR CTGAGGGGTATACCCCTTGT AGG (reversed) Intergenic
No off target data available for this crispr