ID: 1128358878

View in Genome Browser
Species Human (GRCh38)
Location 15:66946670-66946692
Sequence CCGCTGGGAACTGCCCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358878_1128358886 -8 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358886 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
1128358878_1128358888 -1 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data
1128358878_1128358892 23 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358878_1128358884 -9 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358884 15:66946684-66946706 TCCCAGCGGCAGGGCCAGAAAGG No data
1128358878_1128358891 10 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG No data
1128358878_1128358890 7 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358890 15:66946700-66946722 AGAAAGGGATTCTGGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358878 Original CRISPR CCGCTGGGAACTGCCCTGAG GGG (reversed) Intergenic
No off target data available for this crispr