ID: 1128358879

View in Genome Browser
Species Human (GRCh38)
Location 15:66946670-66946692
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358874_1128358879 0 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358879 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
1128358875_1128358879 -8 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358879 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
1128358870_1128358879 25 Left 1128358870 15:66946622-66946644 CCGTGGCTCACAGCTTACTTCAT No data
Right 1128358879 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358879 Original CRISPR CCCCTCAGGGCAGTTCCCAG CGG Intergenic
No off target data available for this crispr