ID: 1128358885

View in Genome Browser
Species Human (GRCh38)
Location 15:66946685-66946707
Sequence CCCTTTCTGGCCCTGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358885_1128358892 8 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358885_1128358890 -8 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358890 15:66946700-66946722 AGAAAGGGATTCTGGAACTCTGG No data
1128358885_1128358893 25 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358893 15:66946733-66946755 CACAGGTATCTTTATGATCTAGG No data
1128358885_1128358891 -5 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG No data
1128358885_1128358894 30 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358894 15:66946738-66946760 GTATCTTTATGATCTAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358885 Original CRISPR CCCTTTCTGGCCCTGCCGCT GGG (reversed) Intergenic
No off target data available for this crispr