ID: 1128358888

View in Genome Browser
Species Human (GRCh38)
Location 15:66946692-66946714
Sequence GCAGGGCCAGAAAGGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358874_1128358888 22 Left 1128358874 15:66946647-66946669 CCAGAGAACCTACAAGGGGTATA No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data
1128358878_1128358888 -1 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data
1128358880_1128358888 -2 Left 1128358880 15:66946671-66946693 CCCTCAGGGCAGTTCCCAGCGGC No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data
1128358875_1128358888 14 Left 1128358875 15:66946655-66946677 CCTACAAGGGGTATACCCCTCAG No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data
1128358881_1128358888 -3 Left 1128358881 15:66946672-66946694 CCTCAGGGCAGTTCCCAGCGGCA No data
Right 1128358888 15:66946692-66946714 GCAGGGCCAGAAAGGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358888 Original CRISPR GCAGGGCCAGAAAGGGATTC TGG Intergenic
No off target data available for this crispr