ID: 1128358889

View in Genome Browser
Species Human (GRCh38)
Location 15:66946698-66946720
Sequence AGAGTTCCAGAATCCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358889_1128358893 12 Left 1128358889 15:66946698-66946720 CCAGAAAGGGATTCTGGAACTCT No data
Right 1128358893 15:66946733-66946755 CACAGGTATCTTTATGATCTAGG No data
1128358889_1128358892 -5 Left 1128358889 15:66946698-66946720 CCAGAAAGGGATTCTGGAACTCT No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358889_1128358894 17 Left 1128358889 15:66946698-66946720 CCAGAAAGGGATTCTGGAACTCT No data
Right 1128358894 15:66946738-66946760 GTATCTTTATGATCTAGGTGAGG No data
1128358889_1128358895 28 Left 1128358889 15:66946698-66946720 CCAGAAAGGGATTCTGGAACTCT No data
Right 1128358895 15:66946749-66946771 ATCTAGGTGAGGAGAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358889 Original CRISPR AGAGTTCCAGAATCCCTTTC TGG (reversed) Intergenic
No off target data available for this crispr