ID: 1128358892

View in Genome Browser
Species Human (GRCh38)
Location 15:66946716-66946738
Sequence ACTCTGGAGGCTGAAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358887_1128358892 7 Left 1128358887 15:66946686-66946708 CCAGCGGCAGGGCCAGAAAGGGA No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358881_1128358892 21 Left 1128358881 15:66946672-66946694 CCTCAGGGCAGTTCCCAGCGGCA No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358885_1128358892 8 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358880_1128358892 22 Left 1128358880 15:66946671-66946693 CCCTCAGGGCAGTTCCCAGCGGC No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358889_1128358892 -5 Left 1128358889 15:66946698-66946720 CCAGAAAGGGATTCTGGAACTCT No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data
1128358878_1128358892 23 Left 1128358878 15:66946670-66946692 CCCCTCAGGGCAGTTCCCAGCGG No data
Right 1128358892 15:66946716-66946738 ACTCTGGAGGCTGAAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358892 Original CRISPR ACTCTGGAGGCTGAAGACAC AGG Intergenic
No off target data available for this crispr