ID: 1128358894

View in Genome Browser
Species Human (GRCh38)
Location 15:66946738-66946760
Sequence GTATCTTTATGATCTAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128358887_1128358894 29 Left 1128358887 15:66946686-66946708 CCAGCGGCAGGGCCAGAAAGGGA No data
Right 1128358894 15:66946738-66946760 GTATCTTTATGATCTAGGTGAGG No data
1128358889_1128358894 17 Left 1128358889 15:66946698-66946720 CCAGAAAGGGATTCTGGAACTCT No data
Right 1128358894 15:66946738-66946760 GTATCTTTATGATCTAGGTGAGG No data
1128358885_1128358894 30 Left 1128358885 15:66946685-66946707 CCCAGCGGCAGGGCCAGAAAGGG No data
Right 1128358894 15:66946738-66946760 GTATCTTTATGATCTAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128358894 Original CRISPR GTATCTTTATGATCTAGGTG AGG Intergenic
No off target data available for this crispr