ID: 1128364389

View in Genome Browser
Species Human (GRCh38)
Location 15:66987040-66987062
Sequence GGTCCCAAAGAAAAACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128364385_1128364389 13 Left 1128364385 15:66987004-66987026 CCTGGCCATTGAGATTTAAAAGA No data
Right 1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG No data
1128364386_1128364389 8 Left 1128364386 15:66987009-66987031 CCATTGAGATTTAAAAGAGCTGG No data
Right 1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG No data
1128364384_1128364389 18 Left 1128364384 15:66986999-66987021 CCAAGCCTGGCCATTGAGATTTA No data
Right 1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128364389 Original CRISPR GGTCCCAAAGAAAAACAAGC TGG Intergenic
No off target data available for this crispr