ID: 1128367854

View in Genome Browser
Species Human (GRCh38)
Location 15:67017343-67017365
Sequence TTGCCCAGGCTGGAGTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701980
Summary {0: 36772, 1: 108043, 2: 179343, 3: 213379, 4: 164443}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128367854_1128367859 29 Left 1128367854 15:67017343-67017365 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 1128367859 15:67017395-67017417 GAAAAAAGAAAAGATGCAGCTGG No data
1128367854_1128367860 30 Left 1128367854 15:67017343-67017365 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128367854 Original CRISPR TTGCCCAGGCTGGAGTGCAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr