ID: 1128367855

View in Genome Browser
Species Human (GRCh38)
Location 15:67017353-67017375
Sequence TTTGCTATTGTTGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95793
Summary {0: 58, 1: 11230, 2: 21411, 3: 31327, 4: 31767}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128367855_1128367860 20 Left 1128367855 15:67017353-67017375 CCAGCCTGGGCAACAATAGCAAA 0: 58
1: 11230
2: 21411
3: 31327
4: 31767
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data
1128367855_1128367861 28 Left 1128367855 15:67017353-67017375 CCAGCCTGGGCAACAATAGCAAA 0: 58
1: 11230
2: 21411
3: 31327
4: 31767
Right 1128367861 15:67017404-67017426 AAAGATGCAGCTGGGAGAAGAGG No data
1128367855_1128367859 19 Left 1128367855 15:67017353-67017375 CCAGCCTGGGCAACAATAGCAAA 0: 58
1: 11230
2: 21411
3: 31327
4: 31767
Right 1128367859 15:67017395-67017417 GAAAAAAGAAAAGATGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128367855 Original CRISPR TTTGCTATTGTTGCCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr