ID: 1128367856

View in Genome Browser
Species Human (GRCh38)
Location 15:67017357-67017379
Sequence GAGTTTTGCTATTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85320
Summary {0: 56, 1: 10573, 2: 20973, 3: 30076, 4: 23642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128367856_1128367859 15 Left 1128367856 15:67017357-67017379 CCTGGGCAACAATAGCAAAACTC 0: 56
1: 10573
2: 20973
3: 30076
4: 23642
Right 1128367859 15:67017395-67017417 GAAAAAAGAAAAGATGCAGCTGG No data
1128367856_1128367861 24 Left 1128367856 15:67017357-67017379 CCTGGGCAACAATAGCAAAACTC 0: 56
1: 10573
2: 20973
3: 30076
4: 23642
Right 1128367861 15:67017404-67017426 AAAGATGCAGCTGGGAGAAGAGG No data
1128367856_1128367860 16 Left 1128367856 15:67017357-67017379 CCTGGGCAACAATAGCAAAACTC 0: 56
1: 10573
2: 20973
3: 30076
4: 23642
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128367856 Original CRISPR GAGTTTTGCTATTGTTGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr