ID: 1128367857

View in Genome Browser
Species Human (GRCh38)
Location 15:67017379-67017401
Sequence TTTTTTCTTTTTTTTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317542
Summary {0: 41, 1: 3835, 2: 90591, 3: 74982, 4: 148093}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128367857_1128367861 2 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367861 15:67017404-67017426 AAAGATGCAGCTGGGAGAAGAGG No data
1128367857_1128367859 -7 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367859 15:67017395-67017417 GAAAAAAGAAAAGATGCAGCTGG No data
1128367857_1128367865 22 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367865 15:67017424-67017446 AGGTGCACAGATGGTGGGCGTGG No data
1128367857_1128367863 16 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367863 15:67017418-67017440 GAGAAGAGGTGCACAGATGGTGG No data
1128367857_1128367860 -6 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data
1128367857_1128367862 13 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367862 15:67017415-67017437 TGGGAGAAGAGGTGCACAGATGG No data
1128367857_1128367864 17 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367864 15:67017419-67017441 AGAAGAGGTGCACAGATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128367857 Original CRISPR TTTTTTCTTTTTTTTGGAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr