ID: 1128367860

View in Genome Browser
Species Human (GRCh38)
Location 15:67017396-67017418
Sequence AAAAAAGAAAAGATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128367856_1128367860 16 Left 1128367856 15:67017357-67017379 CCTGGGCAACAATAGCAAAACTC 0: 56
1: 10573
2: 20973
3: 30076
4: 23642
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data
1128367854_1128367860 30 Left 1128367854 15:67017343-67017365 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data
1128367855_1128367860 20 Left 1128367855 15:67017353-67017375 CCAGCCTGGGCAACAATAGCAAA 0: 58
1: 11230
2: 21411
3: 31327
4: 31767
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data
1128367857_1128367860 -6 Left 1128367857 15:67017379-67017401 CCATCTCCAAAAAAAAGAAAAAA 0: 41
1: 3835
2: 90591
3: 74982
4: 148093
Right 1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128367860 Original CRISPR AAAAAAGAAAAGATGCAGCT GGG Intergenic
No off target data available for this crispr