ID: 1128368018

View in Genome Browser
Species Human (GRCh38)
Location 15:67018433-67018455
Sequence CTGGGAACACAGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128368018_1128368023 8 Left 1128368018 15:67018433-67018455 CCTTCTTCCATCTGTGTTCCCAG No data
Right 1128368023 15:67018464-67018486 ACCAACTGCAGAGCTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128368018 Original CRISPR CTGGGAACACAGATGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr