ID: 1128368787

View in Genome Browser
Species Human (GRCh38)
Location 15:67024095-67024117
Sequence TCCAGGAAACAGACCCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128368780_1128368787 30 Left 1128368780 15:67024042-67024064 CCTGGCTAAGGCCACAGGGTCAT No data
Right 1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG No data
1128368782_1128368787 19 Left 1128368782 15:67024053-67024075 CCACAGGGTCATACTGGAAGTGA No data
Right 1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG No data
1128368784_1128368787 -9 Left 1128368784 15:67024081-67024103 CCAGCCTCAACAAATCCAGGAAA No data
Right 1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128368787 Original CRISPR TCCAGGAAACAGACCCAGGT AGG Intergenic
No off target data available for this crispr