ID: 1128373657

View in Genome Browser
Species Human (GRCh38)
Location 15:67059734-67059756
Sequence CCTAAGCCTGCATGTTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128373648_1128373657 11 Left 1128373648 15:67059700-67059722 CCCTCTGTTCCCTAAGCTGTCAG No data
Right 1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG No data
1128373652_1128373657 2 Left 1128373652 15:67059709-67059731 CCCTAAGCTGTCAGATAGGGCAA No data
Right 1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG No data
1128373649_1128373657 10 Left 1128373649 15:67059701-67059723 CCTCTGTTCCCTAAGCTGTCAGA No data
Right 1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG No data
1128373653_1128373657 1 Left 1128373653 15:67059710-67059732 CCTAAGCTGTCAGATAGGGCAAC No data
Right 1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG No data
1128373647_1128373657 15 Left 1128373647 15:67059696-67059718 CCTGCCCTCTGTTCCCTAAGCTG No data
Right 1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128373657 Original CRISPR CCTAAGCCTGCATGTTTTAG GGG Intergenic
No off target data available for this crispr