ID: 1128374121

View in Genome Browser
Species Human (GRCh38)
Location 15:67063793-67063815
Sequence TGCAAAACAGTTCTCTACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128374121_1128374126 29 Left 1128374121 15:67063793-67063815 CCCGTGTAGAGAACTGTTTTGCA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1128374126 15:67063845-67063867 CTTCCGTGACCCAGGCAGCTGGG 0: 1
1: 0
2: 0
3: 54
4: 292
1128374121_1128374123 21 Left 1128374121 15:67063793-67063815 CCCGTGTAGAGAACTGTTTTGCA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1128374123 15:67063837-67063859 ATCTTTGCCTTCCGTGACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1128374121_1128374125 28 Left 1128374121 15:67063793-67063815 CCCGTGTAGAGAACTGTTTTGCA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128374121 Original CRISPR TGCAAAACAGTTCTCTACAC GGG (reversed) Intronic