ID: 1128374125

View in Genome Browser
Species Human (GRCh38)
Location 15:67063844-67063866
Sequence CCTTCCGTGACCCAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128374121_1128374125 28 Left 1128374121 15:67063793-67063815 CCCGTGTAGAGAACTGTTTTGCA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 287
1128374122_1128374125 27 Left 1128374122 15:67063794-67063816 CCGTGTAGAGAACTGTTTTGCAA 0: 1
1: 0
2: 3
3: 18
4: 230
Right 1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128374125 Original CRISPR CCTTCCGTGACCCAGGCAGC TGG Intronic
900791585 1:4684347-4684369 GCTTCCTAGACCCAGGCAGGAGG - Intronic
900899170 1:5505165-5505187 CCATCTGTGAACCAGGAAGCTGG + Intergenic
901144762 1:7057414-7057436 CCCTCCGTGTGGCAGGCAGCAGG + Intronic
901434640 1:9239699-9239721 CCTTCTGTGCGCCAGGCAGGAGG - Intronic
901764099 1:11489073-11489095 CCTTCACAGGCCCAGGCAGCAGG + Intronic
901963796 1:12849293-12849315 CCCTCCGTCACCCAGTCAGGAGG - Intronic
902230698 1:15025623-15025645 CCTTTCCTGCCCCAGGCAGGAGG + Intronic
902287217 1:15414348-15414370 CCTTCCTGGACGCAGTCAGCAGG + Intronic
902596037 1:17509974-17509996 CCTTCCCTGGCCAAGGCAACTGG + Intergenic
902784865 1:18726453-18726475 CCTTCTGTGTCCCAGGCACTGGG + Intronic
903338372 1:22639396-22639418 CCTTCCCTGGCTCAGGCAGATGG - Exonic
903652439 1:24930145-24930167 CCCGCCGCGGCCCAGGCAGCCGG - Intronic
903693867 1:25193302-25193324 GCTGCCAGGACCCAGGCAGCGGG + Intergenic
903705223 1:25280639-25280661 CCCTCTGTCACCCAGGCTGCTGG + Intronic
906281911 1:44560187-44560209 CCTTCCGTGGGCCAGGCTCCAGG - Intronic
906331754 1:44891127-44891149 CATTCTGTCACCCAGGCTGCTGG + Intronic
906679744 1:47718067-47718089 CCTTTCTGGACCCAGGGAGCAGG + Intergenic
907250687 1:53136697-53136719 CATTCTGTTACCCAGGCAGGAGG + Intronic
908301534 1:62765578-62765600 CGTTCCGTCACCCAGGCTGTAGG - Intergenic
912855025 1:113160144-113160166 CCATCTGTGAACCAGGAAGCTGG + Intergenic
914440343 1:147700175-147700197 CCTTCCGTGAATCTGACAGCCGG - Intergenic
914887354 1:151596343-151596365 CCCTCCGTGGCCCAGGGAGAAGG - Intergenic
918296156 1:183159412-183159434 GCTTCAGTCTCCCAGGCAGCCGG + Intergenic
923525755 1:234771397-234771419 CCTTCCCGGACCCAGGCTGTAGG + Intergenic
924945158 1:248841433-248841455 CCTTCTGAGACACAGGCAACAGG - Intronic
1063089615 10:2850715-2850737 CCATCTGTGAACCAGGAAGCAGG - Intergenic
1063108177 10:3012040-3012062 CCATCTGTGAACCAGGAAGCAGG + Intergenic
1063276825 10:4578409-4578431 CCGTCCATGAACCAGGAAGCCGG - Intergenic
1067210773 10:44259033-44259055 CCATCTGTGAACCAGGGAGCAGG + Intergenic
1067683705 10:48455271-48455293 CTTTCCTTGACCAGGGCAGCTGG - Intronic
1067837396 10:49650070-49650092 CCTAACGGGACCCAGGCAGGAGG + Intronic
1068160072 10:53252272-53252294 CCGTCTGTGAACCAGGAAGCTGG + Intergenic
1069202937 10:65645790-65645812 GCTTCAGTGACCCAAGTAGCTGG + Intergenic
1071086701 10:81874847-81874869 CCTTCAGTGGCCCCGGCGGCCGG - Intergenic
1071547584 10:86540069-86540091 CCTTTCGTGTACCAGGCAGCAGG + Intergenic
1072773475 10:98165175-98165197 CCTTGCTTGAGCCAGGCAGGCGG + Intronic
1073044432 10:100628526-100628548 CCTTCCTTGCCCCAGCCTGCAGG + Intergenic
1073185531 10:101613213-101613235 CCCTCCGTGACCGCGGCAGTGGG + Intronic
1073887559 10:108057607-108057629 CATTCCCTGACCCAGAAAGCTGG - Intergenic
1075057927 10:119233743-119233765 CCTTCCTTGACTCAGGGGGCTGG - Intronic
1075206842 10:120456338-120456360 CCAGCCGTCAGCCAGGCAGCAGG - Intergenic
1075532508 10:123241667-123241689 CCTTCAGTGTCCCAGGCACTGGG + Intergenic
1077514179 11:2991974-2991996 CCTTCAGTGAGGCGGGCAGCCGG + Intronic
1079345617 11:19649510-19649532 CCATCTGTGAACCAGGAAGCAGG - Intronic
1081867389 11:46367190-46367212 CTTTCCGTGACCTCGGCAACAGG - Intronic
1081867864 11:46369516-46369538 CCTTCCGTGAATCAGGCTCCAGG + Exonic
1084480953 11:69419859-69419881 CCGTACGTGTCCCAGGCAGCGGG + Intergenic
1085278963 11:75317861-75317883 CCTGCCGTGACCCAGGCTAGGGG - Intronic
1086819798 11:91421783-91421805 CTTTCAGTGCCCCAAGCAGCAGG + Intergenic
1089400946 11:118164357-118164379 CCATCCTTGAGCCAGCCAGCTGG - Exonic
1089472883 11:118735081-118735103 CTTTCCGAGACCCAGGCGGGCGG - Intergenic
1090041708 11:123298003-123298025 CCAGCCCTGACCCAGGCAGAGGG + Intergenic
1091177565 11:133575465-133575487 CCTCCAGTGACCCAGGGAGCAGG - Intergenic
1091208019 11:133833918-133833940 CCTGCAGTGACCCACGCAGGAGG + Intergenic
1091659750 12:2374517-2374539 CCTTCCGTGGGCCAGGCCTCAGG + Intronic
1091695504 12:2625509-2625531 CCTTCTGTGACACAGGCTGCGGG + Intronic
1092284026 12:7118464-7118486 TCTTCCTTGACCCAGGCAGGTGG - Intergenic
1093730084 12:22557118-22557140 CATTCTGTGAACCAGGAAGCAGG + Intergenic
1096453938 12:51769964-51769986 CCTTCTGTGAAGCAGGCATCTGG - Exonic
1097070478 12:56350881-56350903 CCTTCCTTCCCCCAGGCTGCTGG - Exonic
1100260741 12:92929630-92929652 CCCTCCCTGACCCAGGCGGGAGG + Intergenic
1101908999 12:108848846-108848868 CCTTCCGTGCCACTGTCAGCAGG - Intronic
1103932365 12:124457520-124457542 CCTTCCCTCACCCTGGAAGCTGG + Intronic
1104119918 12:125789311-125789333 CCTTCTGTTACCCAGGCTGGAGG - Intergenic
1104968593 12:132521013-132521035 CCTGCCCTGAGCCAGGGAGCTGG + Intronic
1106610009 13:31269823-31269845 CCATCCATGAACCAGGAAGCAGG + Intronic
1107787164 13:43968890-43968912 CCTTCCGTGAATCAGGCTCCAGG + Intergenic
1110676882 13:78258576-78258598 CCCTCCATGGCCTAGGCAGCTGG + Intergenic
1112702562 13:102028392-102028414 CCATCTGTGACCCAGAAAGCAGG + Intronic
1113261796 13:108572968-108572990 CATTCTGTGACTCAGGCAGAAGG + Intergenic
1113612981 13:111661215-111661237 CCCTCCGAGGCCAAGGCAGCAGG - Intronic
1113715754 13:112505909-112505931 CTTCCCGAGACCCAGGCACCGGG - Intronic
1114762345 14:25330211-25330233 CCTTCCTTGACCCTGGCAGCAGG - Intergenic
1115575023 14:34702817-34702839 CACTCTGTGACCCAGGCTGCTGG - Intergenic
1118443369 14:65831265-65831287 CCCTCAGTGACCCAGGCTGATGG + Intergenic
1121340284 14:93100952-93100974 CCTTCCCTGACGCAGCCATCTGG - Intronic
1122533580 14:102446097-102446119 CCTTCCGTCATCCAGGCGGAAGG + Intronic
1125497227 15:40208085-40208107 CATTCCGTCACCCAGGCTGGAGG - Intronic
1127122778 15:55785877-55785899 CCTCCCCTGCCCCAAGCAGCTGG - Intergenic
1127124097 15:55795374-55795396 CCTTCCCTGATCTAGACAGCTGG - Intergenic
1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG + Intronic
1128914589 15:71548271-71548293 CCTTTCGTTACTCAGGCATCAGG - Intronic
1129465843 15:75723810-75723832 CCTTCCCTGACCCAGGGTCCTGG + Intergenic
1129739162 15:77981634-77981656 CCTCCCGTGGCCCAGGCTGGGGG + Intergenic
1129846796 15:78771555-78771577 CCTCCCGTGGCCCAGGCGGGGGG - Intronic
1132032607 15:98450780-98450802 CATTCAGGGGCCCAGGCAGCTGG - Intronic
1132032628 15:98450864-98450886 CATTCGGGGGCCCAGGCAGCTGG - Intronic
1132087368 15:98919284-98919306 CCTTCCGTGTGGCGGGCAGCAGG - Intronic
1132640501 16:976175-976197 CCATCCGTGGCCCAGGCACTGGG - Intronic
1132682499 16:1148907-1148929 CCTTCAGCCACCCAGTCAGCAGG + Intergenic
1132845557 16:1999454-1999476 CCTCCCGACACCCAGGGAGCAGG + Intronic
1134828717 16:17306012-17306034 CCTTCCCTGACCCAAACAGAAGG + Intronic
1136540515 16:30925466-30925488 CCTTCCCTAGCCCAGGGAGCAGG - Intronic
1136995044 16:35183335-35183357 CCATCCTTGACCCAGACAGTGGG + Intergenic
1139850124 16:69946645-69946667 CTTTCCGAGACCGAGGCAGATGG - Intergenic
1139879109 16:70169559-70169581 CTTTCCGAGACCGAGGCAGATGG - Intergenic
1140373414 16:74425995-74426017 CTTTCCGAGACCGAGGCAGATGG + Intergenic
1140481377 16:75264747-75264769 CTTTCCGTGAAGCAGGCAGTGGG - Intronic
1141522005 16:84586831-84586853 CCTTGGGAGACCAAGGCAGCCGG - Intronic
1141729096 16:85809869-85809891 CCTGCCCTGGGCCAGGCAGCAGG + Intergenic
1142356914 16:89605657-89605679 CCTTCCCTGGCCAAGGCGGCAGG - Intergenic
1144429012 17:15173629-15173651 CCTTCCCTACCCCAGGCAGTGGG + Intergenic
1145837520 17:27965823-27965845 CCATCTGTGAACCAGGAAGCAGG - Intergenic
1147142288 17:38466489-38466511 CCTTCCCAGAGCCTGGCAGCCGG + Exonic
1148091010 17:45022416-45022438 CCTTCCCTGACCCAGTGAGCTGG - Intergenic
1148146114 17:45366172-45366194 CCTTCCTTGACCCCCTCAGCTGG - Intergenic
1148677757 17:49455095-49455117 CCTGCTGTGAGCCAGGAAGCAGG - Intronic
1149614836 17:57988498-57988520 CGGTCCGTGGCTCAGGCAGCTGG + Intergenic
1149962737 17:61130049-61130071 GCTTCTGTGACTCAGACAGCTGG + Intronic
1150825624 17:68472199-68472221 TCTTCTGTGGCCCAGGCAGGTGG + Intergenic
1151268855 17:72977865-72977887 CCTTCGCTCTCCCAGGCAGCTGG - Intronic
1151723987 17:75874314-75874336 CCTTCCCTCTCCCAGGCAGGAGG - Exonic
1151896551 17:76984656-76984678 GCCTCAGTGTCCCAGGCAGCTGG + Intergenic
1151963635 17:77420055-77420077 TCTTCCATGGCCCAGGCACCTGG - Intronic
1153280729 18:3411838-3411860 CCTGCAGTGACCCCAGCAGCAGG + Intronic
1153796097 18:8623624-8623646 ACTGCCTTGACCCAGGAAGCAGG - Intronic
1156290955 18:35748216-35748238 CCTACTGTGTGCCAGGCAGCAGG + Intergenic
1156348823 18:36284997-36285019 CATTCAGTAACCCAGGCAGAGGG - Intergenic
1156568542 18:38223970-38223992 CCATAGGTGATCCAGGCAGCTGG + Intergenic
1156826632 18:41437386-41437408 TTGTCCCTGACCCAGGCAGCTGG - Intergenic
1160707402 19:535997-536019 CCTTCCGGGACCCGGGGCGCTGG + Intronic
1160707439 19:536116-536138 CCTTCCGGGACCCGGGGCGCTGG + Intronic
1160747696 19:719688-719710 CCTTCCGTGACCCCTGCGCCGGG + Intronic
1160755162 19:753092-753114 CCTTCCGTGAGCTGGGCAGGCGG + Intronic
1161356718 19:3823203-3823225 CCTTCCCTGACCGGGGCACCAGG + Intronic
1161575033 19:5050428-5050450 CCTTCTGTCACCCAGGCCGGGGG + Intronic
1162808670 19:13151739-13151761 CCATCCCCGACCCGGGCAGCCGG - Intronic
1163847166 19:19644104-19644126 CCTTCCGTGACCCTCAAAGCTGG + Intergenic
1165330818 19:35140383-35140405 CCTGCCGTGAGTCAGGGAGCTGG + Intronic
1165838636 19:38773806-38773828 CTCTCCGTGTGCCAGGCAGCGGG - Intergenic
1166333790 19:42093357-42093379 CCTACCGTGTCCCAGGAAGAGGG + Intronic
1166553183 19:43680505-43680527 CCTTCCATGAACCAGAGAGCAGG + Intergenic
1166706903 19:44913092-44913114 CCGCCAGTGACCCTGGCAGCTGG - Intergenic
1167492163 19:49799165-49799187 CCTCCAGTGACCCAGACAACTGG - Intronic
1168231704 19:55036664-55036686 ACTTCTGTCACCCAGGCAGGAGG - Intronic
925797737 2:7565033-7565055 CCTTCCAAGACCCAGGCTGAAGG - Intergenic
926018399 2:9474328-9474350 TCTTCCGGGAACCACGCAGCGGG + Intronic
926092489 2:10059883-10059905 CTTTCTGGAACCCAGGCAGCAGG - Intronic
926123924 2:10259900-10259922 CCTTCTCAGACCCTGGCAGCAGG + Intergenic
927087118 2:19683154-19683176 CTCTCCCTGACCCAGGCAGATGG - Intergenic
927847613 2:26479594-26479616 CCTTCCGGGGCCGAGGCCGCTGG + Exonic
927852222 2:26506515-26506537 CCCCCCGGGACTCAGGCAGCAGG - Intronic
927996144 2:27488095-27488117 ACTTCAGTGACCCCAGCAGCTGG + Intronic
928857716 2:35819246-35819268 CCTGCCCTCACCCAGCCAGCTGG - Intergenic
929120105 2:38477220-38477242 CCTTCCGGGGGCCATGCAGCAGG - Intergenic
930058993 2:47273011-47273033 CCTTTCGCGACCCTGGCAGTTGG - Intergenic
932837684 2:75052286-75052308 CCATCCATGAACCAGGAAGCAGG + Intronic
936166930 2:110128982-110129004 CCTTCCCTGACCCAGGGAGCAGG - Intronic
936497758 2:113037209-113037231 CCTTCCGTGTCACAGGCCCCAGG + Intronic
936519352 2:113201963-113201985 CCTCCTGTGACCCAGGGAGCAGG + Exonic
937339518 2:121082265-121082287 CCGTCTGTGAACCAGGAAGCAGG - Intergenic
941779266 2:169426871-169426893 CCTTCCCTGAGCCCGGCAGTCGG - Intergenic
945524754 2:210874429-210874451 CCATCTATGACCCAGGAAGCAGG - Intergenic
946175040 2:217917320-217917342 CCTACCGTGTGCAAGGCAGCGGG + Intronic
946271528 2:218598341-218598363 GCTTCAGTGACCCAAGTAGCTGG - Intergenic
946442959 2:219712526-219712548 CCTTCCCTGACACAAGCAGGAGG + Intergenic
947901776 2:233727303-233727325 CCTTCTGTTTCCCAGGCACCAGG + Intronic
948668365 2:239550644-239550666 CCATCTGTGAACCAGGAAGCAGG - Intergenic
1169877600 20:10315037-10315059 CCTTTCTTGTCCCAGGCAGATGG - Intergenic
1171905386 20:30895152-30895174 GCTTTCGTGAGCCAGACAGCAGG - Intergenic
1173836567 20:46129901-46129923 CATTCCGTGAGCCTGACAGCAGG - Intergenic
1174091382 20:48051371-48051393 CATTCCGTGATCCAGTCTGCTGG + Intergenic
1174106161 20:48163885-48163907 CCTCCCGTGAAGGAGGCAGCTGG + Intergenic
1174168726 20:48603459-48603481 CCTTCCCTGGCCCTGGGAGCTGG + Intergenic
1174335134 20:49854338-49854360 CCTTCTGTTCCTCAGGCAGCAGG + Intronic
1175798364 20:61786240-61786262 CCTTCCTGGCCCCAGGCAGGAGG + Intronic
1175838496 20:62011788-62011810 CCTGCCATGAGCCAGGCAGTGGG - Intronic
1175973609 20:62699347-62699369 CCCTCCGTGAGCCAGGAAGCAGG + Intergenic
1176029432 20:63004968-63004990 CCATCCGGGATCCAGGGAGCCGG - Intergenic
1177835427 21:26182022-26182044 CTTTGGGTGACCCAGGCAGGTGG - Intergenic
1179980139 21:44891406-44891428 CCTTCCTTGACCCTAGGAGCTGG - Intronic
1180859063 22:19066702-19066724 CCCTCCATGCCCCAGCCAGCTGG - Intronic
1181017667 22:20080467-20080489 CCCTCCGGGACCGAGGCCGCGGG + Intronic
1181408989 22:22704817-22704839 CCCTCAGTGACACAGGCAGATGG + Intergenic
1181772721 22:25138248-25138270 CCTTCCATCAGCCATGCAGCCGG - Intronic
1182300895 22:29336332-29336354 CCTCCCATGACCAAGGCAGTGGG + Intronic
1182307378 22:29379978-29380000 CTTTCCTTCAGCCAGGCAGCGGG - Intronic
1182755005 22:32672536-32672558 CCATCCCTGCCCCAAGCAGCAGG - Intronic
1184691732 22:46120338-46120360 CCTCTCCTGGCCCAGGCAGCAGG - Intergenic
1184876995 22:47282473-47282495 CCTTTCCTTACCCAGGCAGGGGG + Intergenic
1185165235 22:49257846-49257868 CCGTCTGTGAACCAGGAAGCGGG + Intergenic
1185166341 22:49264917-49264939 CCTCCCGTGAGCCAGGACGCAGG - Intergenic
1185388471 22:50547131-50547153 CCGTCTGAGACCCAGGCTGCAGG - Intergenic
950195766 3:11008059-11008081 CAAGCCTTGACCCAGGCAGCTGG - Intronic
950681079 3:14585502-14585524 ACTTCTGGGACCGAGGCAGCTGG + Intergenic
951853277 3:27167098-27167120 CCTTCTGTCACCAAGGCAACAGG - Intronic
952710760 3:36429835-36429857 CCCTGCCTGACCCAGGCTGCTGG + Intronic
953246530 3:41199187-41199209 CCTTCCCCAACCCAGGCCGCGGG + Intronic
954562061 3:51565371-51565393 CATTTTGTCACCCAGGCAGCTGG - Intronic
954871843 3:53773351-53773373 TCTTCTGTGACCCAAGCAGAGGG + Intronic
955397856 3:58569655-58569677 GCTTGCGGGGCCCAGGCAGCAGG + Intronic
957184496 3:76924414-76924436 CCATCTGTGAACCAGGAAGCAGG + Intronic
957627906 3:82678599-82678621 CTTTTCGTGACCCAGCCAGGTGG - Intergenic
958748908 3:98171518-98171540 CTTTCCGTGACCAACACAGCTGG + Intronic
960997944 3:123351870-123351892 CCTTCCCTGACCCAGGCAGTCGG + Intronic
961511527 3:127406737-127406759 CCTTCAGTGCCCCAAGCAGATGG + Intergenic
961634138 3:128322238-128322260 CCTGCCATCACCCAGCCAGCAGG - Intronic
961905825 3:130262045-130262067 CCTGGAGTGAACCAGGCAGCCGG + Intergenic
964458857 3:156898477-156898499 CCATCTGTGAACCAGGAAGCAGG + Intronic
966711588 3:182978622-182978644 GCTTCGGTGACCCAGGGTGCTGG + Intronic
966910519 3:184557127-184557149 CCCTCCAGGCCCCAGGCAGCTGG - Intronic
966938665 3:184731239-184731261 CCTTCCCTGACCCAGCATGCTGG - Intergenic
967259369 3:187626807-187626829 CCATCTGTGAACCAGGAAGCAGG + Intergenic
968039130 3:195573765-195573787 TCCTCCCTGACCCAGGCTGCCGG + Intronic
968148272 3:196317954-196317976 CCTTCCGTGGCCCAGGTCCCAGG + Intronic
968661156 4:1799355-1799377 CCATCCTTGACCCAGACAGTGGG - Exonic
969256718 4:6007437-6007459 CCATCTGTGAACCAGGAAGCAGG + Intergenic
969315976 4:6381481-6381503 GCTTCCCTGACCCAGGTTGCTGG - Intronic
969537641 4:7766544-7766566 CCTCCCGTGACACAGTCACCTGG - Intronic
969537647 4:7766579-7766601 CCTCCCGTGACACAGTCACCTGG - Intronic
969547122 4:7837440-7837462 CCATCTGTGAACCAGGAAGCAGG + Intronic
969632407 4:8346342-8346364 CCTCCTGAGAGCCAGGCAGCGGG + Intergenic
969675660 4:8613028-8613050 CCTTCCAGAACCCAGGCAGAGGG + Intronic
971707010 4:30058130-30058152 CTTTCCGAGACCAAGGCAGGAGG + Intergenic
978371278 4:108031608-108031630 CCTTCCAGGACCCAGGCATGGGG + Intronic
979791323 4:124784843-124784865 CTTTCCCTGACCCAAGCAGTTGG + Intergenic
982063242 4:151625356-151625378 CCTTCTGTCACTCAGGCAGGTGG - Intronic
982209360 4:153022178-153022200 CCTCCCGTGTCCCAGTCACCTGG - Intergenic
983432951 4:167674432-167674454 CCTTCTATGAACCAGGAAGCAGG - Intergenic
984715117 4:182917644-182917666 CCACGCGTGACCCGGGCAGCGGG - Intronic
986146825 5:5085590-5085612 CCTTCTGTCACACAAGCAGCTGG - Intergenic
987303982 5:16620828-16620850 CCTTCTGTGAGCCAGGCACTGGG - Intergenic
987916868 5:24226676-24226698 CCAGCCTTGACACAGGCAGCTGG + Intergenic
992557205 5:77915657-77915679 CCTTCTGTGGGCCAGGGAGCAGG + Intergenic
993386457 5:87268248-87268270 CTTCCCGTAACCCAGGCAGCTGG + Exonic
997623418 5:135315464-135315486 CCTTCCAGGACCCAGGCTGCAGG + Intronic
999644050 5:153700649-153700671 CCTTCCCTGCACAAGGCAGCTGG - Intronic
1001695527 5:173667236-173667258 CCTTCCTGGACACAGCCAGCTGG - Intergenic
1001995274 5:176152439-176152461 AATTCCGTAACCCAGGCAGGGGG + Intergenic
1002442719 5:179272743-179272765 CCTGCCGTCAGCCAGGCAGCTGG + Intronic
1003642595 6:7888167-7888189 CCTTCCTTCACTCAGGTAGCAGG - Intronic
1003696608 6:8412153-8412175 CCTTCTGTGAACCAGAAAGCAGG + Intergenic
1005071315 6:21865002-21865024 CCTTCTGTCACCCAGGCTGGAGG + Intergenic
1005981399 6:30839714-30839736 CCTGAGGTGCCCCAGGCAGCTGG + Intergenic
1006055029 6:31377801-31377823 CCATCCTTGACCCAGACAGTGGG - Intergenic
1006452010 6:34110781-34110803 CCCTCCCTGGCCCAGGCTGCAGG + Intronic
1007417985 6:41703171-41703193 CCTTCCCTGCCCTAAGCAGCTGG - Intronic
1007842485 6:44728124-44728146 CCATCATTGCCCCAGGCAGCAGG - Intergenic
1009663039 6:66638274-66638296 TCTTCCGGGATCCAGGCTGCTGG + Intergenic
1012199175 6:96384373-96384395 CCTTCAGTGACACAGGCGCCAGG - Intergenic
1012465505 6:99512976-99512998 CCTTCCATGACCCTTACAGCAGG + Intronic
1013785745 6:113778177-113778199 CGCTCTGTCACCCAGGCAGCTGG - Intergenic
1015466004 6:133549492-133549514 CCTTCCCTGACACAGGGAGTTGG - Intergenic
1015567947 6:134593221-134593243 CCTCCCGGGACCCTGGCAGGAGG - Intergenic
1015719714 6:136228476-136228498 CCTTCTATGAACCAGGAAGCAGG + Intergenic
1015803183 6:137080998-137081020 CCTCCCAGGGCCCAGGCAGCTGG + Intergenic
1018027277 6:159816192-159816214 CCTGCCCCGCCCCAGGCAGCAGG + Intronic
1018302366 6:162417351-162417373 CCTTTCCTGCCCCCGGCAGCCGG + Intronic
1018802703 6:167236153-167236175 CCTCCCGCGACCCAGGAACCCGG + Intergenic
1019067064 6:169311129-169311151 CCTTCCATGAGGCAGGCACCAGG + Intergenic
1019202892 6:170333314-170333336 CCATCTGTGAACCAGGAAGCGGG + Intronic
1021617798 7:22520528-22520550 CCCTCTGTCACCCAGGCAGGAGG + Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1023665663 7:42520745-42520767 CCACCCCTGACCCAAGCAGCTGG - Intergenic
1023838054 7:44079941-44079963 CCTTCCTTGGCCCAGCCACCTGG + Exonic
1024481993 7:49873301-49873323 CCATCCATGAACCAGGAAGCAGG - Intronic
1026307631 7:69155415-69155437 TCTTCAGTGACACAGGCAGAAGG - Intergenic
1028553975 7:92103035-92103057 CCTTCCTAGGTCCAGGCAGCTGG + Intronic
1030190943 7:106809459-106809481 CCATCTGTGAACCAGGAAGCAGG - Intergenic
1032457067 7:132081218-132081240 CCTTTCACAACCCAGGCAGCAGG - Intergenic
1032813095 7:135442812-135442834 CCTTGGGTGGCCAAGGCAGCAGG + Intronic
1032841936 7:135721351-135721373 CCTGCAGGGACCCAGGCAGGGGG + Intronic
1033448964 7:141446155-141446177 ACTTCAGTAACCCAGGCAGCAGG + Intronic
1036371690 8:8168007-8168029 CCTTCAGTGAACGGGGCAGCTGG + Intergenic
1036432307 8:8702299-8702321 CCTGCCGTGCCCCAGGCTCCGGG - Exonic
1036566864 8:9945308-9945330 CCATCTGTGAACCAGGAAGCAGG - Intergenic
1036879213 8:12497637-12497659 CCTTCAGTGAACGGGGCAGCTGG - Intergenic
1040512117 8:48105102-48105124 CCTTCTGTGCCCCAGGGATCTGG + Intergenic
1040588562 8:48767120-48767142 CCATCTGTGAGCCAGGAAGCAGG + Intergenic
1041425876 8:57720012-57720034 CCATTTGTGACCCATGCAGCTGG - Intergenic
1041630963 8:60086528-60086550 CCTTCTGCGAACCAGGAAGCAGG - Intergenic
1041732298 8:61075091-61075113 CCATCCGTGACCCAGGCTGAAGG + Intronic
1043628647 8:82297231-82297253 CCATCTGTGAACCAGGAAGCAGG - Intergenic
1048150163 8:131886107-131886129 CCATCCGTGAACCAGGAAGTGGG - Intergenic
1048434154 8:134400244-134400266 CCATCCATGAACCAGGAAGCAGG + Intergenic
1049232615 8:141492355-141492377 CCCTCTGTGTCCCAGGCAGCGGG + Intergenic
1051837026 9:21350780-21350802 CCTCCTGTGACCCAGGCTGTGGG + Exonic
1053067304 9:35077788-35077810 CCCTCTGTCACCCAGGCTGCAGG + Intronic
1053525715 9:38828331-38828353 CCTTCTGTCACCCAGGCTGGAGG - Intergenic
1054197948 9:62052766-62052788 CCTTCTGTCACCCAGGCTGGAGG - Intergenic
1054640408 9:67535605-67535627 CCTTCTGTCACCCAGGCTGGAGG + Intergenic
1055339929 9:75270373-75270395 CCTTCTGTGAACCAGGGAGTAGG + Intergenic
1056027242 9:82511770-82511792 CATTCTGGGTCCCAGGCAGCAGG + Intergenic
1056487450 9:87073120-87073142 CTTCCCCTGACCCAGGCAGATGG - Intergenic
1058958784 9:109973384-109973406 CATTCCTGGACCCAGGCTGCAGG + Intronic
1060459750 9:123839409-123839431 CCTTCTGTGTGCCAGGCAGTGGG - Intronic
1060999762 9:127896565-127896587 CCTTCCCACACCAAGGCAGCTGG + Intronic
1061200121 9:129133178-129133200 CCTTCCCTGAGGCAGGCAGATGG + Intronic
1061878733 9:133557784-133557806 GCCTCCCTGACCCAGGCAGTGGG - Intronic
1062533566 9:137012011-137012033 GCTTCCTTGCCCCAGGCTGCAGG - Exonic
1062623605 9:137433438-137433460 CCTGCCTGGACCCAGGGAGCAGG + Exonic
1203777426 EBV:81585-81607 CCATCCCTGACACAGGCTGCGGG + Intergenic
1203501530 Un_KI270741v1:27213-27235 TCTTCCGTCACCCAGGCTGGAGG + Intergenic
1185721003 X:2381343-2381365 CCGTCTGTGAACCAGGAAGCAGG + Intronic
1186795639 X:13044402-13044424 CCTGCCCTGACCCAGGCCCCAGG + Intronic
1187297406 X:18015193-18015215 CCATCTGTGAACCAGGAAGCAGG + Intergenic
1187547723 X:20268412-20268434 CCTCCCGGGACCCAGACACCTGG + Intergenic
1187768813 X:22672327-22672349 CCATCAGTGAACCAGGAAGCGGG + Intergenic
1187940482 X:24376005-24376027 GCTTCCCTCACCCAGGCAGGAGG - Intergenic
1190297120 X:49034233-49034255 GATTCCCTGACACAGGCAGCTGG + Exonic
1198142242 X:133816081-133816103 CCTTCTGTCACCCAGGCTGCAGG + Intronic
1199785624 X:151102482-151102504 CCTTCAGTGACCCAGGAATGGGG - Intergenic
1199996810 X:153030930-153030952 TCTTGGGAGACCCAGGCAGCTGG - Intergenic
1200044953 X:153396498-153396520 TCTTGAGAGACCCAGGCAGCTGG + Intergenic
1200097043 X:153669334-153669356 CCTTCCCAGTCCCAGGCACCTGG + Intergenic
1200287118 X:154833968-154833990 CATTCTGTGACCCAGCCAACAGG + Intronic