ID: 1128374125

View in Genome Browser
Species Human (GRCh38)
Location 15:67063844-67063866
Sequence CCTTCCGTGACCCAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128374122_1128374125 27 Left 1128374122 15:67063794-67063816 CCGTGTAGAGAACTGTTTTGCAA 0: 1
1: 0
2: 3
3: 18
4: 230
Right 1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 287
1128374121_1128374125 28 Left 1128374121 15:67063793-67063815 CCCGTGTAGAGAACTGTTTTGCA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128374125 Original CRISPR CCTTCCGTGACCCAGGCAGC TGG Intronic