ID: 1128374244

View in Genome Browser
Species Human (GRCh38)
Location 15:67064560-67064582
Sequence ATTCAGGGGCGTCTGCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128374244_1128374248 -10 Left 1128374244 15:67064560-67064582 CCTGCGGGCAGACGCCCCTGAAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1128374248 15:67064573-67064595 GCCCCTGAATTCTTTTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1128374244_1128374254 25 Left 1128374244 15:67064560-67064582 CCTGCGGGCAGACGCCCCTGAAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1128374254 15:67064608-67064630 GAGCTCCCCAATGTGCCAATTGG 0: 1
1: 0
2: 0
3: 2
4: 75
1128374244_1128374252 3 Left 1128374244 15:67064560-67064582 CCTGCGGGCAGACGCCCCTGAAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1128374252 15:67064586-67064608 TTTGGTGGGGAGAAAAGCCGCGG 0: 1
1: 0
2: 1
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128374244 Original CRISPR ATTCAGGGGCGTCTGCCCGC AGG (reversed) Intronic
900648264 1:3718642-3718664 CTGCCGGGGCCTCTGCCCGCAGG + Intronic
905091609 1:35434924-35434946 CTTCAGAGGGGTCTGCCCGTTGG + Exonic
909106211 1:71412138-71412160 ATTCAGGGACCTCTGCCATCTGG + Intronic
915284921 1:154846442-154846464 AGCCAGGAGCGTCTGCCCCCCGG + Intronic
1067737477 10:48869326-48869348 ATTCAGGGGCCCTTGCCCACAGG + Intronic
1070051676 10:72895635-72895657 ATTCAGGGGCGGCTGTCTGCCGG + Intronic
1074976025 10:118582302-118582324 ATTCAGGTGCGTCTGCCATGTGG + Intergenic
1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG + Intergenic
1076861387 10:133139832-133139854 ATGCAGGGGCAGCTGCCCGTGGG - Intergenic
1076913543 10:133405071-133405093 ATTCAGGGGAATCTGCCACCCGG - Intronic
1085725363 11:78950295-78950317 ATTCAGGGGCCTCTGGCCAGGGG + Intronic
1100441288 12:94619478-94619500 ACTCAGGGGCCTCTGCCTGGAGG - Intronic
1103885269 12:124195705-124195727 ATTCAGGGGCGACTTCCTGGAGG - Intronic
1104044977 12:125155498-125155520 ATTGATGGGCTCCTGCCCGCTGG + Intergenic
1105702677 13:22944663-22944685 ACTCAGAGGCGCCTCCCCGCGGG - Intergenic
1105855310 13:24366457-24366479 ACTCAGAGGCGCCTCCCCGCGGG - Intergenic
1112342907 13:98567203-98567225 AGTCAGTGGTGTCTGCGCGCTGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113505277 13:110812331-110812353 ATCCAGGGGCCTCTGCCCAGAGG - Intergenic
1119390776 14:74289736-74289758 ATTCTGGGGCCCCTGCCCTCAGG - Intronic
1121931200 14:97973934-97973956 ATTCACTGGGGTCTGCCCGTGGG + Intronic
1128374244 15:67064560-67064582 ATTCAGGGGCGTCTGCCCGCAGG - Intronic
1129922175 15:79328808-79328830 CTCCAGGGGCCTCTGCCCCCAGG - Intronic
1131599167 15:93829316-93829338 ATTCAGGTGCATCTGCCATCGGG + Intergenic
1141935589 16:87236049-87236071 ATCCAGGGGCTGCTGCCCACCGG - Intronic
1152296980 17:79473463-79473485 ATTCAGGGACGTCAGCCTGATGG + Intronic
1160715615 19:575345-575367 CTTCAGGGGCGTCTGCGGGTTGG + Intronic
1167270349 19:48502453-48502475 ATGCAGGTGCGCCAGCCCGCGGG + Exonic
1171240892 20:23566278-23566300 ATTCATGGGTGTCTGCCCTGGGG - Intronic
1179285001 21:39969704-39969726 GTCCAGGGGCCTCTGCCCCCAGG - Intergenic
1181015000 22:20063708-20063730 GTGCCGGGGCGTTTGCCCGCAGG - Intronic
1181574844 22:23787195-23787217 CTTCACGGGCTTCTGCCCGAAGG - Exonic
949548862 3:5096105-5096127 CTGCAGGGGCTTCTGCCGGCAGG - Intergenic
961438849 3:126938792-126938814 ATGCAGGGGTCTCTGCCTGCAGG + Intronic
968473531 4:792389-792411 ACTCAGGGCCGCCTTCCCGCAGG + Intronic
969491346 4:7500863-7500885 ATTCTGCGGGGGCTGCCCGCAGG - Intronic
981077757 4:140607806-140607828 ACTCAGGGTAGTCTGCCCACAGG + Intergenic
990512430 5:56500706-56500728 ATTCAGGGACATCTGCCTTCAGG + Intergenic
999256337 5:150211762-150211784 ATTCAGGTGCTTCTTCCCACGGG + Intronic
1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG + Intergenic
1003272777 6:4621910-4621932 ATTCAGGGGCATCTGCCACACGG + Intergenic
1005434098 6:25789050-25789072 CTTCTGGGGCCTCTGCCCTCAGG - Intronic
1007334036 6:41138495-41138517 ATTCAGGGGTGTCTGCCTTTGGG + Intergenic
1013119131 6:107125917-107125939 TTCCAGGGGCCTCTGCCCTCCGG + Intergenic
1019692747 7:2425890-2425912 ATTCTGGGGAGTCTGCACTCTGG + Intronic
1032369144 7:131328353-131328375 ATTCGGGGTAGTTTGCCCGCGGG - Intronic
1036799497 8:11779734-11779756 ATCAAGGGTCTTCTGCCCGCTGG - Exonic
1041689823 8:60678447-60678469 CTTCAGGCGGGTCTCCCCGCCGG - Intergenic
1048280734 8:133103794-133103816 ATTCAGAGGCTTCTGTGCGCTGG + Intronic
1048851001 8:138645359-138645381 ATTCAGGGCGGGCTGCTCGCAGG - Intronic
1053463731 9:38289972-38289994 ACTCAGGGGCCTCTGTCTGCTGG - Intergenic
1061543131 9:131288967-131288989 AATCAGGGACGGCTGCCCCCAGG - Intergenic
1185890089 X:3815587-3815609 ACTGAGGGGCGTCTGGCTGCGGG - Intergenic
1190774584 X:53542504-53542526 AGTCAGAGGCGTCTGTCCGGAGG - Exonic