ID: 1128375965

View in Genome Browser
Species Human (GRCh38)
Location 15:67076241-67076263
Sequence ATAGAGAAGGTGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 854
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 777}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128375965_1128375972 1 Left 1128375965 15:67076241-67076263 CCCTCCCCCATCACCTTCTCTAT 0: 1
1: 0
2: 3
3: 73
4: 777
Right 1128375972 15:67076265-67076287 ATTATTCTTAAAAATTTGTTTGG 0: 1
1: 0
2: 5
3: 148
4: 1388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128375965 Original CRISPR ATAGAGAAGGTGATGGGGGA GGG (reversed) Intronic
900088234 1:908690-908712 AGAGGGGAGGGGATGGGGGAGGG + Intergenic
900393755 1:2444764-2444786 AGGGAGAAGGCCATGGGGGAAGG - Intronic
900411829 1:2516051-2516073 AGGGAGGTGGTGATGGGGGAGGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
900971140 1:5992986-5993008 AGACAGAAAGGGATGGGGGAAGG - Intronic
901034616 1:6328911-6328933 AGGGAGAAGGTCGTGGGGGATGG - Intronic
901216118 1:7556251-7556273 ATAGAGGAGGTTGTGGGGTATGG + Intronic
901872649 1:12147067-12147089 AAAAAGGAGGTGAGGGGGGAAGG + Intergenic
902483354 1:16724478-16724500 ATAGAGAGAGAGAGGGGGGAAGG + Intergenic
902654734 1:17859526-17859548 AGAGAGAGAGAGATGGGGGAGGG + Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903471909 1:23593186-23593208 AGAGGGAAGGTGATTGGGCAGGG + Intronic
903678245 1:25080034-25080056 ATTGAGAAAGTGAGGGGAGAAGG - Intergenic
903861463 1:26367319-26367341 ATAGCCAAGGTCATGGGGGTTGG - Intronic
904346980 1:29879119-29879141 ACAGAGCAGGGGAAGGGGGAGGG - Intergenic
904902209 1:33866369-33866391 ATGCAGAAAGTAATGGGGGAGGG + Intronic
905014318 1:34766757-34766779 CTAGAGTAGGTGAGGGGTGAAGG - Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905307642 1:37030550-37030572 ATAAAGCAGGTGTTGGGGGGGGG - Intronic
905323643 1:37134782-37134804 ATTGAGAAGGTGTGGGAGGAGGG + Intergenic
905358164 1:37399265-37399287 GGAAAGAAGGTGATGGGGAAAGG - Intergenic
905397585 1:37676930-37676952 GTAGAGTAAGTGATGGGGGTGGG - Intergenic
905473766 1:38211674-38211696 GTGGGGGAGGTGATGGGGGATGG - Intergenic
905807418 1:40887007-40887029 ATAGGCAAGGGGCTGGGGGAGGG - Intergenic
905844197 1:41213442-41213464 ACAGAGGAGGAGATGGAGGAAGG - Intronic
906416307 1:45623197-45623219 AGGGTGAAGGAGATGGGGGACGG - Exonic
906489900 1:46260212-46260234 AGAGAGTAGATGATTGGGGAAGG + Intronic
906586289 1:46981981-46982003 ATAGATGGGGAGATGGGGGAGGG + Intergenic
906925484 1:50111198-50111220 AGAGAGGAGGTGAGGGGGAAGGG + Intronic
907267165 1:53269609-53269631 GTAAAGAAGGTGAAGGGGGGTGG - Intronic
907270444 1:53287973-53287995 ATAGAGACGGGGGTGGGGGTGGG + Intronic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
908185431 1:61648253-61648275 ATAAAGAAGGAGATGTGGCAAGG + Intergenic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908704072 1:66931028-66931050 AAAGTGAAGGTGGTGGGGGGAGG - Intronic
908831732 1:68185657-68185679 ACAGATGAGGGGATGGGGGATGG - Intronic
908878367 1:68703045-68703067 TTAGGGAAGATGATGGGGGATGG - Intergenic
909599185 1:77442963-77442985 ACAGAGAAGGTCATGAAGGAAGG - Intronic
909982403 1:82118085-82118107 TTAGACAAGGTGATCAGGGAAGG - Intergenic
909993145 1:82247950-82247972 ATAGAGAAGGTGGGGGGATAGGG + Intergenic
910950947 1:92647681-92647703 AGAGGGAAGGTGAAGGGGGCAGG + Intronic
911771873 1:101753884-101753906 GGAGAGAAGGTGATGAGAGATGG - Intergenic
911828286 1:102516062-102516084 ATAGATATAGTGATTGGGGAAGG + Intergenic
912515447 1:110213871-110213893 ATAGAGATAGAGATGGGGAAAGG + Intronic
912559995 1:110544064-110544086 ATAAAGAAGGTGGTGGAGCATGG + Intergenic
912711453 1:111952828-111952850 AGAGACAAGGGGATGGAGGAGGG + Intronic
912746388 1:112248942-112248964 ACAGAGGAGGGGATGGAGGACGG - Intergenic
913063905 1:115232237-115232259 ATAGAGATGGGGATGGGGATGGG + Intergenic
913124611 1:115773385-115773407 TGAGAGAAGGAGATGGAGGATGG + Intergenic
914442852 1:147722310-147722332 GTGGAGAAGGTGATGGGGGTGGG + Intergenic
915384861 1:155481183-155481205 ATACAGTAGGTGATGGGGAAGGG + Exonic
915571787 1:156748877-156748899 AAAGAGAAGGTACAGGGGGAAGG + Intronic
915727072 1:158025502-158025524 AGAGAGATGGGGGTGGGGGACGG + Intronic
916357258 1:163926030-163926052 ATAGAGAAGATGGTGGGGTAAGG + Intergenic
916542164 1:165767577-165767599 ATAGAGAATGAAATGGGGAAAGG - Intronic
916885985 1:169068833-169068855 ATAGAGCAGGATATGGGGCAAGG + Intergenic
917180230 1:172288286-172288308 ATAGATTAGGTGAAGGGAGAAGG + Intronic
917193090 1:172439513-172439535 ATTGTGAAGGTGGTGGGAGACGG - Intronic
917210858 1:172630708-172630730 AGAGACAAGGTGTTGGGGCAAGG + Intergenic
917216246 1:172681055-172681077 GCAGAGAAGGCAATGGGGGATGG - Intergenic
917674557 1:177306334-177306356 ATAAGGAAGGTGATGGGGAATGG + Intergenic
917717692 1:177754607-177754629 AGAGAGAAGGTGGAGGGAGAAGG + Intergenic
917930568 1:179819814-179819836 TGAGAGAAGGTGTTGGGGTAAGG + Intergenic
918131719 1:181635267-181635289 CTAGAGAAGGGGTTGTGGGAGGG + Intronic
918471283 1:184877531-184877553 TTAGAGAACGTGATACGGGAGGG - Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918754662 1:188324231-188324253 ATAGTGAAGGAGATTGGGGCAGG + Intergenic
918924322 1:190761495-190761517 GTAGTGAAGGTGAGGGAGGATGG + Intergenic
920195203 1:204222162-204222184 AAAGACAAGGTGATGAGAGATGG - Exonic
920228526 1:204455310-204455332 AGAGAGAAGGGGAAGGGGGTTGG + Intronic
920381341 1:205536275-205536297 ATAAGGAGGGTGATGGGGCAGGG + Intergenic
920667291 1:207972362-207972384 ACAGAGAAGGTGCTGGAAGAGGG - Intergenic
920711428 1:208298940-208298962 AGAGAGATGGGGCTGGGGGAGGG + Intergenic
920881664 1:209886567-209886589 AAAGAGAAGGGAATAGGGGAGGG + Intergenic
920943862 1:210510199-210510221 GTAGAGGAGGAGATGGGAGAGGG + Intronic
921011517 1:211146428-211146450 AGAGAGAAAGTGACAGGGGATGG - Intergenic
921702698 1:218285447-218285469 ATAGTGAAGGTAATGTGGTAGGG + Exonic
921894088 1:220380695-220380717 AAAGAGAAAGAAATGGGGGAGGG + Intergenic
921992002 1:221376947-221376969 ATAGATAAAATGAGGGGGGATGG + Intergenic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922022137 1:221716062-221716084 ACAGAGAAGGTGTAGGGAGAGGG - Intronic
922347447 1:224708105-224708127 AGAGAGAAGGGGTTGAGGGATGG - Intronic
922421182 1:225462082-225462104 CAAGAGAAGGTGTTGAGGGAAGG + Intergenic
923059980 1:230462931-230462953 ATAGGGCAAGTTATGGGGGATGG - Intergenic
923149597 1:231221262-231221284 AAAGTGGATGTGATGGGGGAAGG - Intronic
923334015 1:232951250-232951272 ATGGAGATGGGGATGGGGGTGGG - Intronic
923608178 1:235464436-235464458 AGGGAGAAGGTGGTGAGGGAGGG - Intronic
924348207 1:243092495-243092517 GCAGAGCAGGTGATGGGAGAGGG + Intergenic
924395671 1:243617685-243617707 ATAGAGAAAGTGATGGGGTGGGG + Intronic
924609565 1:245562595-245562617 AGAGAGAAGAGCATGGGGGAAGG - Intronic
1064628527 10:17285729-17285751 AGAGAGAAGGGAAAGGGGGAGGG + Intergenic
1065464092 10:26000966-26000988 AGAGAGAGAGTGATGGGGGAAGG + Intronic
1065796370 10:29311960-29311982 AAAGGGAAGGGGAAGGGGGAGGG + Intronic
1067541039 10:47153386-47153408 ACATAGCAGGTGGTGGGGGATGG - Intergenic
1067823790 10:49554595-49554617 ATAGAGATAGGGATGGGGGAGGG + Intergenic
1067852905 10:49766444-49766466 AAGGAGGAGGTGATGTGGGAGGG - Intergenic
1068212045 10:53932957-53932979 AGAGAGAGAGTGGTGGGGGAAGG - Intronic
1068436178 10:56994040-56994062 ATAAAGAAGGTGGTAAGGGAAGG - Intergenic
1068929755 10:62577228-62577250 ATTGTGAAGGTTATGGGAGATGG + Intronic
1069202462 10:65638128-65638150 AGAGAAAAGGGGATGGGGGATGG - Intergenic
1070489102 10:76959081-76959103 GTAGAGAAGGTGGTTGGAGAGGG - Intronic
1070777470 10:79118217-79118239 ATAGAGGAAGGGATGGGGGGAGG + Intronic
1070843362 10:79503322-79503344 AGAGAGAAGGTGGAGGGTGAGGG - Intergenic
1071539861 10:86471114-86471136 ATAGAGCAGGTTAGGGGGGCTGG + Intronic
1071981519 10:91008638-91008660 ATACTTAAGGTGATTGGGGAGGG - Intergenic
1072656858 10:97335383-97335405 GTAGAGACGGTGGTGGGGGGGGG + Intergenic
1073101266 10:101007933-101007955 GGAGAAAAGGTGATGGAGGAAGG + Intronic
1073217009 10:101842024-101842046 CTAGGGACAGTGATGGGGGATGG + Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073599385 10:104831837-104831859 AGCAAGTAGGTGATGGGGGAGGG + Intronic
1073701594 10:105933966-105933988 CAAGAGAGAGTGATGGGGGAAGG - Intergenic
1074180743 10:111060371-111060393 ATAGAGAAGGAAAAGGGTGAGGG - Intergenic
1074256327 10:111806273-111806295 ATGGAGAAGATGATGTGGAAAGG - Intergenic
1074409212 10:113211039-113211061 AGAGAGGAGGGGATGGGAGAGGG - Intergenic
1075235134 10:120721123-120721145 ACAGAGAAGGTTGTGGGGTAGGG + Intergenic
1075557590 10:123444611-123444633 ATGGAGAGGGAGATGGGGGGCGG + Intergenic
1075682393 10:124342077-124342099 AATGACAAGGTGATTGGGGATGG - Intergenic
1075962614 10:126582290-126582312 ATTGAGAAGGAGTTGGGGCAGGG - Intronic
1077416996 11:2428644-2428666 ATAGTGATGGTGATGGTGGTGGG + Intergenic
1077555530 11:3224220-3224242 ATAGAGGAGGGGCTGGGGGTGGG + Intergenic
1077632092 11:3817639-3817661 AGGGACAAGGGGATGGGGGAAGG + Intronic
1077913958 11:6598911-6598933 ATAGGCAAGGTGCTGAGGGAAGG - Exonic
1077934920 11:6773445-6773467 AGAGAAAAGGTGTTGGGGCAAGG + Intergenic
1078187485 11:9064891-9064913 ATAGAGGTGGTCATGGGGGTGGG - Intronic
1078488068 11:11742306-11742328 AGAGAGAAAGGGATTGGGGAGGG - Intergenic
1078569530 11:12445326-12445348 ATAGAGAAAGTGGTGTGGGGAGG + Intronic
1078769452 11:14334797-14334819 ATAGGGAAGATGTTGGAGGAGGG - Intronic
1079108121 11:17587342-17587364 ATAGAGAGAATGCTGGGGGACGG + Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1080111490 11:28572987-28573009 ATAAAGAAGGAGGTGGGGGTGGG + Intergenic
1080263914 11:30381076-30381098 ATGGAGATGGTGGTGGAGGATGG + Intergenic
1080688414 11:34535030-34535052 ATAGATAAGGTCATGAGGGTGGG - Intergenic
1080741194 11:35065951-35065973 ATGGAAAAGGGGATGGGGCAAGG - Intergenic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1082835867 11:57649784-57649806 ATTGGGAAGGGGATGGGGGTGGG + Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1083967871 11:66053693-66053715 AGGGGGGAGGTGATGGGGGAGGG + Intronic
1084775827 11:71374408-71374430 ATAGGGAAGCTGCTGGAGGAAGG + Intergenic
1085157892 11:74312601-74312623 AGAGAGGAGGTGATGGGTGCTGG + Intergenic
1085309320 11:75506910-75506932 ACAGAGAAGGGGAGGGGGGCAGG - Intronic
1085758795 11:79224087-79224109 ATAGAGATGGTGAGAGGAGAGGG - Intronic
1085816337 11:79741336-79741358 GGAGAGAATGTGAAGGGGGAAGG - Intergenic
1086449524 11:86902242-86902264 ATAGATAAGGTTTTAGGGGAGGG - Intronic
1086595901 11:88570041-88570063 AAAGAGAAGGGGAAGGGGAAAGG + Intronic
1086866703 11:91988173-91988195 ACAAAGAAAGTGATGGGGAAAGG + Intergenic
1086922237 11:92600833-92600855 TTAGAGAAGATGGTTGGGGAAGG + Intronic
1087426017 11:97987101-97987123 ATATAGAAGATGGTGAGGGATGG + Intergenic
1088964198 11:114701499-114701521 ATAGAGCAGGGGATCTGGGAAGG - Intronic
1089659776 11:119978311-119978333 ATGGAGAAGGTGGTGAAGGAGGG + Intergenic
1089943600 11:122444443-122444465 ATATAGGAGGTGATGGGTAAGGG - Intergenic
1090241879 11:125189515-125189537 ATTGTTAAGGTGATGGGGCAGGG - Intronic
1090249572 11:125241989-125242011 ATGGTGAAGGTGGAGGGGGATGG + Intronic
1090607045 11:128432338-128432360 AGAGAGCTGGTGGTGGGGGAAGG - Intergenic
1091345716 11:134852521-134852543 ACAGAGAGGGTGACGGGAGAGGG - Intergenic
1091836338 12:3588745-3588767 AGAGAGACTGTGATGGGGAAGGG + Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092284725 12:7122133-7122155 TCAGAGAAGGTGGTGGAGGAGGG + Intergenic
1092380937 12:7996571-7996593 CCAGAGAATGTGACGGGGGAAGG - Intergenic
1092449199 12:8586044-8586066 ATAGCCCAGGTGATGGGTGAAGG + Intergenic
1092529887 12:9335410-9335432 AAAGAGAAGGTGCTGGGGGCAGG - Intergenic
1092601598 12:10072171-10072193 AAAGAGAAGGGGCTGGGGGGAGG - Intronic
1092931133 12:13316924-13316946 ATAGAAAAGCTGATGGGGCTGGG - Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093623091 12:21315357-21315379 ATAAAGAAACTAATGGGGGAAGG + Intronic
1094766127 12:33596811-33596833 AAAGAGAAGGTTGTGGGGGGCGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095152863 12:38816374-38816396 ATAAAGAAAGAAATGGGGGAAGG + Intronic
1095279147 12:40329382-40329404 CTTGAGAAGGTGATGGGAAAAGG - Intronic
1095428622 12:42107692-42107714 AAAAAAAAGGTGTTGGGGGAGGG + Intronic
1095741062 12:45607777-45607799 AAATAGAAAGTGATGGGGAAAGG + Intergenic
1096463585 12:51836323-51836345 GTTGAGCAGCTGATGGGGGAGGG - Intergenic
1096782651 12:53999961-53999983 AGAGAGAAGGGGGTGGGAGAGGG + Intronic
1097125349 12:56770173-56770195 AAAGAGAAGATGGTGGGGGAGGG + Intronic
1097306033 12:58069985-58070007 ATACAGAAGGAAATGGAGGAAGG + Intergenic
1097579481 12:61436539-61436561 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1097892449 12:64791754-64791776 ATGGAGGGGGTGGTGGGGGAAGG + Intronic
1097922234 12:65088737-65088759 CTAGAGAAAGTGATTGGAGAAGG - Intronic
1098146966 12:67507313-67507335 GAAGAGAAGGTAATGGGGAAAGG - Intergenic
1098285389 12:68901879-68901901 AGAGAGAAGGGGAGAGGGGAGGG + Intronic
1098466997 12:70798751-70798773 ATAGAGAATGTGATGAGGGTGGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099099868 12:78425349-78425371 ATTAAGAAGGGGATGAGGGAGGG + Intergenic
1099148506 12:79078249-79078271 AGAGTGAAGGTGAGGGGAGAAGG - Intronic
1099473612 12:83080862-83080884 ATAGACCATGTGGTGGGGGATGG - Intronic
1099596175 12:84669260-84669282 TTTGAGAAGGTGATGGAGTATGG - Intergenic
1100428899 12:94512781-94512803 ATAGGGGAAGTTATGGGGGAAGG - Intergenic
1100580908 12:95939627-95939649 ACAGAGAAGGCAGTGGGGGAAGG + Intronic
1100836646 12:98572862-98572884 ATAGGGCAAGTTATGGGGGAGGG + Intergenic
1100972306 12:100083414-100083436 AAAGTGAAGGGTATGGGGGAGGG + Intronic
1101262629 12:103048188-103048210 ATAGGGAAAGGAATGGGGGAAGG + Intergenic
1101693024 12:107098401-107098423 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102653602 12:114461530-114461552 GTAGAGATGGTGCTGGGGGAAGG - Intergenic
1102694154 12:114785167-114785189 ATAGACTTGGGGATGGGGGAAGG + Intergenic
1102709137 12:114909952-114909974 AAAGAGAAGAAGATGGGAGAGGG - Intergenic
1102769769 12:115465312-115465334 CAAGAGAAGGTGATGCGTGAAGG - Intergenic
1102785669 12:115602572-115602594 AAAGAGAAGGGGATGAGGGAAGG - Intergenic
1102983290 12:117259201-117259223 AGACAAAAAGTGATGGGGGAAGG + Intronic
1103162312 12:118739727-118739749 ATATAGAAAGGAATGGGGGAAGG + Intergenic
1103223426 12:119266152-119266174 AGAGAGAAGGGGATGGGGCAGGG - Intergenic
1104050417 12:125190556-125190578 ATAGTGATGGTGATAGGGAAGGG + Intronic
1104050434 12:125190623-125190645 ATGGTGATGGTGATGGGGAAGGG + Intronic
1104050555 12:125190974-125190996 ATGGTGATGGTGATGGGGAAGGG + Intronic
1104050640 12:125191236-125191258 ATGGTGATGGTGATGGGGAAGGG + Intronic
1104284799 12:127415049-127415071 AGAGTGAATGGGATGGGGGAGGG + Intergenic
1104545165 12:129704484-129704506 ACAGAGACAGTGATGGGGGCAGG + Intronic
1106544891 13:30721789-30721811 ATTGAAAAGATGATGTGGGAGGG - Intronic
1106708179 13:32303507-32303529 ATAGAGATGATGAAGGGGCAAGG - Intergenic
1107158134 13:37193685-37193707 ATGGAAAAGGGCATGGGGGATGG + Intergenic
1108070460 13:46623852-46623874 ACAGAGATGGGGAGGGGGGAGGG - Intronic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108114935 13:47116732-47116754 AGAGAGGGGGTGGTGGGGGAGGG + Intergenic
1108526664 13:51291393-51291415 ATAGCAAAGGTGATGGGGCCAGG - Intergenic
1109003695 13:56840345-56840367 ATGGACATGGTGGTGGGGGAAGG - Intergenic
1109225747 13:59692699-59692721 ATAGAGTAGGTTATGGTTGATGG - Intronic
1109455090 13:62576298-62576320 ATAGAGAAGATGCTGAGGGACGG - Intergenic
1110141768 13:72139150-72139172 ATAGAGAAGATGGTGTTGGAGGG + Intergenic
1110164059 13:72416399-72416421 GTAGATAAGATGATGGAGGAAGG - Intergenic
1110659177 13:78038633-78038655 GAAGAGTAAGTGATGGGGGAGGG - Intergenic
1110882085 13:80584487-80584509 ACAGGGATGGTGATGGAGGATGG + Intergenic
1110969183 13:81739685-81739707 AGAGAGAAGGTGTTGGGGCTTGG - Intergenic
1111903920 13:94233410-94233432 AAAGAGCAGATAATGGGGGATGG - Intronic
1112053494 13:95668858-95668880 AAAGAGATGGTGGTGGGGGGCGG - Intergenic
1112187335 13:97139939-97139961 ATAGAGGAAGTGATGGCTGAAGG - Intergenic
1112550924 13:100419546-100419568 TTATAGAAGGTTATGGGGAAAGG + Intronic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1112717403 13:102202437-102202459 AGAGAGAAGGTGATAAGTGAGGG + Intronic
1113036681 13:106057441-106057463 ATAGAGGGGGTCATGGAGGATGG + Intergenic
1113596193 13:111535286-111535308 ATAAAGAAGGTGGGCGGGGAGGG - Intergenic
1113605286 13:111600368-111600390 AAAGACAAGGGGCTGGGGGAGGG + Intronic
1113913954 13:113860161-113860183 ACAAAGAAAGAGATGGGGGAAGG + Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114671315 14:24412834-24412856 ATAGAGAAGGGGATGGGCTCGGG + Intronic
1114692270 14:24595155-24595177 CCAGTGAAGGTGGTGGGGGAAGG + Intergenic
1115889439 14:38010696-38010718 AGAGAGAGAGTGGTGGGGGAAGG - Intronic
1116118693 14:40694036-40694058 ACAGAAAAGCTGATGGGGCAGGG + Intergenic
1116443818 14:44985445-44985467 ATAGACTAGGGGGTGGGGGATGG + Intronic
1116609489 14:47049283-47049305 ATGGAGATGGAGGTGGGGGAAGG + Intronic
1116896359 14:50319078-50319100 AGATTGATGGTGATGGGGGAGGG + Intronic
1117825882 14:59703110-59703132 ATTGAGAATGTGATGGAGGGAGG - Intronic
1118160709 14:63287120-63287142 ATAGTAAAGGTGATGAGAGAAGG - Intronic
1118412963 14:65501856-65501878 TTAGTTAATGTGATGGGGGAGGG + Intronic
1118745657 14:68771205-68771227 ACAGAGAAGGTGATGGTGGGAGG - Intergenic
1118902666 14:69999651-69999673 ATTGAGCTGGGGATGGGGGATGG + Intronic
1118905273 14:70018960-70018982 TTAGAGAAGGTAAGGCGGGACGG - Intronic
1118982278 14:70726514-70726536 ACAGAGAAGGAAATGGGAGAGGG - Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1119888047 14:78160765-78160787 GTGGACAAGGTGATGGGGCATGG + Intergenic
1120168041 14:81220954-81220976 AGAGACAGGGTGAAGGGGGAGGG + Intronic
1121433237 14:93902225-93902247 AGAGACAAGGTGTTGGGGTAAGG - Intergenic
1121897845 14:97664975-97664997 ATAGAGAAGGTTCTTGGGGCAGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122411520 14:101528377-101528399 TCAGAGAAGGTAAGGGGGGACGG + Intergenic
1122600547 14:102919579-102919601 AGATGGAAGGTGATGGTGGATGG - Intergenic
1122625187 14:103081769-103081791 AAAGAGATGGTGATGGTAGATGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1125320657 15:38484394-38484416 GTAGAGGAGGTGGTGGGGGTGGG + Exonic
1126341210 15:47642899-47642921 ATGGAGAAGGAAATGCGGGAAGG + Intronic
1126510309 15:49464049-49464071 ATACAGCAGGTGTTTGGGGATGG - Intronic
1127166404 15:56248140-56248162 AGAGAGAAGAGGATGTGGGAGGG + Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128164929 15:65455558-65455580 ATAGACAAGGTGGTGGTGGTAGG - Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128986667 15:72227033-72227055 TTAAAGAAGCTGTTGGGGGAAGG - Intronic
1129320284 15:74770936-74770958 CTAGAGGAGGTGCTGGGGGGTGG - Intergenic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1129785984 15:78310409-78310431 AGAGACAGGGTGATGGGGGAAGG + Intergenic
1129815597 15:78550502-78550524 ATAGAGACGGTGAGCAGGGAAGG + Exonic
1130856023 15:87840841-87840863 ATAGAGAAAGTGAGGGAGGAAGG + Intergenic
1130862477 15:87903407-87903429 ACAGGGAAGATGATGGAGGAGGG - Intronic
1131337997 15:91568830-91568852 AGAGACAAGGTGTTGGGGCAAGG + Intergenic
1131404364 15:92152028-92152050 AAAGGGCATGTGATGGGGGAAGG + Intronic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1131951675 15:97688238-97688260 ATAGAAAAGGGGATGGCTGACGG + Intergenic
1132714577 16:1284363-1284385 GCACAGATGGTGATGGGGGAGGG + Intergenic
1133415854 16:5606460-5606482 AGAGAGAAGGTGAGGAAGGAAGG - Intergenic
1134000134 16:10776429-10776451 ATAGAGCAGGTGATGGCAGTGGG + Intronic
1134031208 16:10993892-10993914 ACAGAGAAGGTGACCTGGGATGG + Intronic
1134302642 16:13005340-13005362 ATATAGAAGATGCTGGGGTATGG + Intronic
1134345082 16:13383160-13383182 AGAAAGAAGGTGGTGGGAGATGG + Intergenic
1134449568 16:14354620-14354642 GAAGAGGAGGGGATGGGGGAGGG + Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134849582 16:17469822-17469844 ACAGAGAAGGTGAAGACGGAAGG + Intronic
1135421485 16:22308258-22308280 AAAGAGAGGGTGATGAGGGTGGG + Intronic
1135609101 16:23849315-23849337 ATAGTGTAGGTGAAGGTGGAGGG + Intronic
1135788322 16:25370775-25370797 AGAGACAAGGTGTTGGGGCAAGG + Intergenic
1135854461 16:25994078-25994100 TTAGATAAGGTCATGAGGGATGG - Intronic
1135936680 16:26786375-26786397 ATAGATTATGTGAAGGGGGAAGG + Intergenic
1136143694 16:28302948-28302970 ATAGAGCAGGGCATGGGGGGGGG + Intronic
1136452783 16:30363423-30363445 ATAGAGAATGTGAGTGGGGATGG - Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1137878577 16:52021914-52021936 GTAGAGAAGATGAAGGGGAAAGG - Intronic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139338947 16:66254574-66254596 ATAGAGAAAGTGAAGGGGGGAGG - Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139875244 16:70140834-70140856 ATAGAAAAGAAAATGGGGGAGGG + Intronic
1140217439 16:73019774-73019796 ATAGAGAAAGGGAAGGGGGCGGG - Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140579120 16:76207640-76207662 ATAAAGGAGGTGGTGGGGTATGG + Intergenic
1140698383 16:77558257-77558279 ATAGAGAATGGGATTGGGGCAGG + Intergenic
1140743899 16:77964461-77964483 AGAGAGCAGGTGATGGGACAAGG - Intronic
1141068054 16:80929870-80929892 ATAGACCAGGTGATCAGGGAAGG + Intergenic
1141220801 16:82067903-82067925 AAAGAGAAAGGCATGGGGGAAGG - Intronic
1141475964 16:84273676-84273698 ACAAAGAAGGTGATTGGGGCTGG + Intergenic
1141495087 16:84404030-84404052 ATAGGGCAGGTAATGGGGGAAGG + Intronic
1141662324 16:85448118-85448140 CCAGAGAAGGTGATGCGGGCAGG - Intergenic
1142177185 16:88650699-88650721 CGAGAGAAGGGAATGGGGGAGGG + Intronic
1142477452 17:197835-197857 AAAGAGAGGGTGGTGGGGCATGG - Intergenic
1142601099 17:1053335-1053357 TTCGAGAAGGGGCTGGGGGAGGG + Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143186787 17:5014829-5014851 ATGGAGAAGGTAATGGCTGAGGG + Exonic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143500728 17:7337047-7337069 CCAGAGCAGGTGCTGGGGGAGGG - Intronic
1143901613 17:10178688-10178710 AAAAAAAAGGTGGTGGGGGAGGG - Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144028496 17:11299701-11299723 AGAGAGAAGGTGATGGGATGGGG - Intronic
1144098624 17:11924137-11924159 ACAGAGCAGGTGAGGGGAGAAGG - Intronic
1144131513 17:12251191-12251213 ATAGAGGAGGTGGCTGGGGATGG + Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144768972 17:17748646-17748668 ATAGAAAAGGTGTAGGAGGATGG + Intronic
1144833646 17:18145256-18145278 ATAGAGCAGGAGGTGGGGGCTGG + Intronic
1145058492 17:19718049-19718071 GTGGAGAAGGTGTTGGAGGAGGG - Intronic
1145398866 17:22515486-22515508 AGAGAGAAGGAGAGGAGGGAAGG + Intergenic
1146265799 17:31451791-31451813 CTTGAGAGGGTGGTGGGGGAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146655294 17:34631399-34631421 GCAGAGAAGGTGCTGGGTGAGGG - Intronic
1146686338 17:34844009-34844031 ATAAAGAAGGTGGTTGGGGTAGG + Intergenic
1147126672 17:38374643-38374665 AAAAAGAAGGTGAAGGGTGAAGG + Intronic
1147384966 17:40075654-40075676 GAGGGGAAGGTGATGGGGGAGGG - Intronic
1147720537 17:42536941-42536963 AAAGAGAAGGTGGGGGAGGAAGG - Intronic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148089319 17:45013336-45013358 AAAGAGAAAGTGAGGAGGGAGGG - Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148860681 17:50602880-50602902 ACAGTGAAGGTGATGGGGGCTGG + Exonic
1149411347 17:56410699-56410721 AGAGAGACGGTGGTGGGGGCTGG - Intronic
1149475886 17:56960665-56960687 GTAGTGGAGGGGATGGGGGATGG - Intronic
1149548047 17:57518951-57518973 AGAGAGGAGGCGATGAGGGAAGG - Intronic
1151197997 17:72445576-72445598 ACAGTGAGGGTGGTGGGGGAGGG + Intergenic
1151199550 17:72457649-72457671 ACAGAGGAGGTGTTGGGGGTTGG - Intergenic
1151238787 17:72741710-72741732 AGAGGGAAGGTGATGGGAGCTGG + Intronic
1151482904 17:74380570-74380592 ACGGTGAAGGTGATGGGGCAGGG + Intergenic
1151859051 17:76745682-76745704 AGAGGGAGGGAGATGGGGGATGG - Intronic
1151935255 17:77257315-77257337 ATGGAGGAGGTGATGGGGATGGG - Intergenic
1152386222 17:79976416-79976438 AGAGAGAAGAGGATGGAGGAAGG + Intronic
1152426564 17:80221335-80221357 GGAGAGAGGGTGATGAGGGACGG + Intronic
1152609237 17:81307485-81307507 AAAGGGAAAGTGAAGGGGGAGGG - Intergenic
1153283753 18:3438366-3438388 AGAGAGAAGGTGAGGGAGGGAGG + Intronic
1153450425 18:5221222-5221244 AGAGAGAGAGAGATGGGGGAGGG - Intergenic
1153499025 18:5729632-5729654 AAAGAGGAGGTGGAGGGGGAAGG - Intergenic
1153588128 18:6644967-6644989 AGAGAGAACGAGTTGGGGGAGGG + Intergenic
1154052424 18:10973708-10973730 AAAGAGAAGGGGACGGGGCAAGG + Intronic
1155063034 18:22245552-22245574 ATAAACAAGGTGATGGAGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156039375 18:32803164-32803186 ACCAAGATGGTGATGGGGGAGGG - Intergenic
1156488742 18:37484025-37484047 AGAGAGAAGGTGAGAGGGGGAGG - Intronic
1156504962 18:37584566-37584588 TAAGAGAAGGTGATGGGAGAGGG - Intergenic
1156696263 18:39772103-39772125 AAAGAGAAGGTCATGAGTGAAGG - Intergenic
1156841909 18:41618964-41618986 TTGGAGAAGGGGATGGGGGCTGG - Intergenic
1157566553 18:48682592-48682614 AGATAGAAGGGGATAGGGGAAGG - Intronic
1158007299 18:52687092-52687114 AGAGTAAAGGTTATGGGGGAGGG - Intronic
1158642253 18:59213800-59213822 AGAGAGTAGGTGATGGCGCAAGG - Intergenic
1158709948 18:59828695-59828717 TTAGAGTAGTTGATTGGGGAGGG - Intergenic
1158871669 18:61694094-61694116 ATAGGGAAGGGCATGTGGGAAGG + Intergenic
1158894953 18:61904047-61904069 TTAGAGAAGGGGATGGGTGTGGG + Intergenic
1158924820 18:62245091-62245113 AAAGAGAAGGTGAGGAGGAAAGG - Intronic
1159445207 18:68533890-68533912 ATAGTGAAGTGGATGGGGTACGG - Intergenic
1159846209 18:73463742-73463764 ATATAGAAGGGGGTGGGAGAGGG - Intergenic
1159947939 18:74457634-74457656 TCAGAGAAGTTGGTGGGGGAGGG - Intronic
1160239423 18:77112553-77112575 ACAGAGAAGGGGGAGGGGGAGGG - Intronic
1160674670 19:383498-383520 TTAGACGAGGTGATTGGGGAAGG - Intergenic
1160816655 19:1039127-1039149 AGAGAGGAGGTCTTGGGGGATGG + Intergenic
1160965472 19:1745357-1745379 GAAGAGAAGGGGATTGGGGAGGG - Intergenic
1161151624 19:2713131-2713153 ATGGAGGAGGTGATGGGTGGAGG - Intergenic
1162019190 19:7860965-7860987 GGAGAGAGGGGGATGGGGGAGGG + Intronic
1162156860 19:8684332-8684354 AGAGATGGGGTGATGGGGGAGGG - Intergenic
1162973878 19:14197357-14197379 AGGGAGAAGGTGTTGGGGGCGGG - Intronic
1163354695 19:16802542-16802564 ATACAAAAGGTGAAGGGGGTTGG - Intronic
1163401943 19:17099362-17099384 CTGCAGAAGGTGATGGGGGGAGG + Intronic
1164678931 19:30121247-30121269 ATGGAGAAATGGATGGGGGATGG - Intergenic
1165362384 19:35344937-35344959 ATAGAGGAGGTGGTGGGGGATGG - Intronic
1165936561 19:39392598-39392620 ATATAGAAGGTGAGGTGGGCGGG - Intronic
1166074115 19:40403971-40403993 TTAGAGACGGGGGTGGGGGACGG + Intronic
1166197126 19:41214431-41214453 TTAGAGAGGATGATGGGGGAAGG - Intergenic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166301691 19:41914914-41914936 ACAGAGACGGAGATGGTGGAGGG - Intronic
1166530555 19:43540667-43540689 ATAGATAGGATGATTGGGGATGG - Intergenic
1166863501 19:45822851-45822873 AGGGAGAAGGTGGTGGGGGTGGG + Intronic
1167101703 19:47407675-47407697 AGAGAGACTGTGTTGGGGGAGGG + Intronic
1167286666 19:48602267-48602289 ACAGAGAGGGTGAAAGGGGAAGG + Intronic
1167566567 19:50261122-50261144 GGAGAGGGGGTGATGGGGGAGGG - Intronic
1167682294 19:50931215-50931237 ATAGAGAAAGTGATGGAAGAAGG - Intergenic
1168008378 19:53509457-53509479 GTAGAGAAGGTGGTTGGAGATGG + Intergenic
1168075274 19:53978042-53978064 AGAGAGAAGGGGTTTGGGGAAGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925398596 2:3555315-3555337 AGAGACAAGGTGTTGGGGCAAGG - Intronic
925669900 2:6300467-6300489 ATAGAGATGGTGATGTGGTTTGG + Intergenic
925912503 2:8582933-8582955 AGAGGGAAGGTGGTGGAGGAAGG - Intergenic
926132076 2:10309676-10309698 AAATAGAAGGGGCTGGGGGAGGG + Intronic
926258730 2:11236496-11236518 ATGAACAAGGTGATGGGGAAGGG - Intronic
926372488 2:12194007-12194029 ATTGTGAAGGTGTTGGGAGATGG + Intergenic
926425903 2:12738480-12738502 GCAGAGAAGGTGAGGAGGGATGG - Intronic
926572202 2:14541995-14542017 TAAGAGAGGGTTATGGGGGAGGG + Intergenic
926838375 2:17050109-17050131 ACTGAGAAGGTGATGTTGGATGG - Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
927247617 2:20970240-20970262 AAACAGAAGTTGATGGGGGTGGG - Intergenic
927432645 2:23040180-23040202 GGAGAGCAGGGGATGGGGGAAGG + Intergenic
928066029 2:28165477-28165499 TTAGAGAAAATGGTGGGGGAAGG + Intronic
928185900 2:29110527-29110549 ATAGGGAAGGTTATGGGGAAGGG + Intronic
928238255 2:29564115-29564137 AGAGACAAGGTGTTGGGGCAAGG - Intronic
928692164 2:33811293-33811315 ATAGACCTGGTCATGGGGGAGGG + Intergenic
929097618 2:38278848-38278870 AGAGGGAGAGTGATGGGGGAAGG + Intergenic
929462770 2:42115825-42115847 ATAGAGAAGGTGGAGTGCGATGG - Intergenic
929934257 2:46282820-46282842 ATAGGGAAGGTGACGTAGGAAGG + Intergenic
929977996 2:46653678-46653700 ATAGAGCAGGTGAAGGGAGTGGG - Intergenic
930302208 2:49630634-49630656 AGAGAGAAGGGGAAGGGGAAAGG + Intergenic
930347914 2:50208572-50208594 AGAGAGGAGGTGGTGGTGGAGGG + Intronic
930364409 2:50421324-50421346 ATTTAGAAAGTGAAGGGGGAAGG - Intronic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
931669491 2:64634364-64634386 GGAGATAAGGTGATGGGGGGGGG + Exonic
931686649 2:64799821-64799843 GTACAGAAGATGATGGAGGAGGG - Intergenic
932190276 2:69735504-69735526 AGAGACAAGGTGTTGGGGCAAGG - Intronic
933401478 2:81803012-81803034 ACAGAGTAGGGGCTGGGGGAAGG - Intergenic
934485840 2:94709048-94709070 AGAGAGAGAGTGAAGGGGGAGGG + Intergenic
934523435 2:95034082-95034104 ATGGCAAAGGTGATGGGGGCGGG - Intronic
935245632 2:101216655-101216677 ATAGGGCAGGGCATGGGGGAAGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935353256 2:102174090-102174112 ATGGAGTAGGTGATGGGGAGGGG - Intronic
935669251 2:105541405-105541427 ACAGAGAGGGTCATGGGGGAAGG - Intergenic
936028647 2:109053833-109053855 AAAGGGAACTTGATGGGGGAGGG - Intergenic
936400326 2:112159931-112159953 AGATGGAAGGTGATGGGGGAAGG - Intronic
937777857 2:125801928-125801950 AAGGAGAAGGTGGTGGGTGAGGG + Intergenic
938055349 2:128210039-128210061 TTAGATGAGGTGATGGGGGCAGG - Intergenic
940883420 2:158968875-158968897 GTGGAGAGGGTGATGGGAGAAGG + Intronic
940922785 2:159328266-159328288 CAAGAAAAGGTGATGGGGGTTGG - Intronic
941366781 2:164620079-164620101 AGAGAGAAGGCGGTGGGGGGGGG - Intronic
941381364 2:164796729-164796751 AGAGGGAAGGTCAAGGGGGAAGG + Intronic
941456362 2:165715046-165715068 GCAGAGAAGGTGTTGGGGCACGG + Intergenic
942379271 2:175371389-175371411 TTAGATAAGGAGATGAGGGAGGG - Intergenic
942572536 2:177328428-177328450 ATGGAGAAGGTAATTGGAGATGG + Intronic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
942699848 2:178693460-178693482 ACAAAGGATGTGATGGGGGACGG - Intronic
942887660 2:180947279-180947301 ATAGAGAAGCTCATATGGGAAGG - Intergenic
942911111 2:181245416-181245438 GTAGATAAGTTGCTGGGGGAGGG + Intergenic
942961700 2:181837268-181837290 TTAGAGAAGGTGGTTAGGGAAGG + Intergenic
943173198 2:184431568-184431590 ATAGAGAATGTAATGTGGCAAGG + Intergenic
943195760 2:184746692-184746714 CTGGAAAGGGTGATGGGGGAGGG - Intronic
943766270 2:191665682-191665704 ATAGAGAAGGAGATGATGGTGGG + Intergenic
944054850 2:195512989-195513011 ATAGAGAAGGTGAGAGGTGTGGG + Intergenic
944172282 2:196793159-196793181 AAAGAGACATTGATGGGGGAGGG + Intronic
944276323 2:197842467-197842489 TTAGAGGTGCTGATGGGGGATGG - Intronic
944502836 2:200379528-200379550 ATAGCTAAAGAGATGGGGGAAGG + Intronic
944535665 2:200707271-200707293 ATAGAGGAAGGGATGTGGGAAGG + Intergenic
945033609 2:205686048-205686070 TTAGAGAAGGCGCTGGGGGGCGG - Intronic
945570835 2:211465495-211465517 AGAGAGAAGATAATAGGGGAAGG + Intronic
945834429 2:214822091-214822113 AGAGAGAGGGTGGTTGGGGAAGG + Intergenic
945854432 2:215051643-215051665 TGTGTGAAGGTGATGGGGGAAGG + Intronic
946086402 2:217177613-217177635 ATAGAGATGGTTATGGGGGTGGG - Intergenic
946091749 2:217231817-217231839 ATGGAGAAGGTCATGTGGCAAGG + Intergenic
946254518 2:218433013-218433035 ATGGAGAAGGGGATGGGTGGTGG + Intronic
946462501 2:219881645-219881667 ATAGAGGAGGTGAGGTGGGATGG - Intergenic
946669688 2:222089485-222089507 ATGGAGAAAGTGATAGGGAAGGG - Intergenic
946710228 2:222497841-222497863 TTAGAGAAGGTGGTTGGAGAGGG + Intronic
947429445 2:230013236-230013258 ATGGAAAATGAGATGGGGGAGGG - Intergenic
947480764 2:230497679-230497701 ATTCAGCAGGTGATGGGGGTAGG - Intronic
947708508 2:232295277-232295299 ATGGGGAGTGTGATGGGGGAAGG - Intronic
947741061 2:232485185-232485207 AGTGAGAAGGTGCTGGGGCATGG - Exonic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948295139 2:236855176-236855198 ATAGAGCAGGAGGTGGGGGTGGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948362455 2:237432732-237432754 ATAAAGAAGGTTCTGGGGAAGGG + Intergenic
948768927 2:240237539-240237561 GGAAAGAAGGTGGTGGGGGAGGG - Intergenic
949043992 2:241862311-241862333 TGAGAAAAGGAGATGGGGGAGGG - Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169554607 20:6736044-6736066 ATAGAGAAAGTGTTGGAGCATGG - Intergenic
1169560055 20:6790212-6790234 ATAGAGAGGCCCATGGGGGACGG - Intergenic
1170057180 20:12219293-12219315 CTAGAGTTGGGGATGGGGGAAGG + Intergenic
1170327377 20:15171445-15171467 ATAAGGAGAGTGATGGGGGAAGG - Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171209891 20:23309206-23309228 ACAGAGGAGGGAATGGGGGAAGG - Intergenic
1172261391 20:33568948-33568970 AGGGAGGAGGTGATGGGGGTGGG - Intronic
1172292172 20:33784228-33784250 AGAGGGAGGGAGATGGGGGAGGG - Intronic
1173040768 20:39460258-39460280 AGAGAGAAAGAGATGGGGCATGG + Intergenic
1173501934 20:43560076-43560098 ACAGTCAAGGTGATGGGGGAGGG + Intronic
1174436640 20:50511330-50511352 TTAGAGAAGGGGATCAGGGAAGG + Intronic
1174584075 20:51593878-51593900 ATGGAAAAAGTGTTGGGGGATGG - Intergenic
1175356854 20:58375419-58375441 AGAGAGAGAGGGATGGGGGAGGG - Intergenic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1176808771 21:13516448-13516470 AAAGAGAGGGTGGTGGGGGGGGG + Intergenic
1176965091 21:15204120-15204142 ATAGAGAAGGCAATGCGTGAAGG + Intergenic
1177579887 21:23007790-23007812 CGAGAGCGGGTGATGGGGGATGG + Intergenic
1178237289 21:30857623-30857645 ATAGGGAAAGTTATAGGGGAAGG + Intergenic
1178726426 21:35056593-35056615 ATAGATAAGGAAATGGAGGAAGG - Intronic
1179063046 21:37997461-37997483 AGAGAGAGAGTGGTGGGGGAAGG + Intronic
1179340895 21:40508077-40508099 GTAGAGAAGGGGATGGAGTATGG + Intronic
1180635378 22:17259223-17259245 ATTAGGAAGGTGATGGGGCAGGG + Intergenic
1181513179 22:23397853-23397875 GCAGAGAAGTTGATGGGGAACGG + Intergenic
1182039644 22:27226724-27226746 ATAGAGAAGGTGACCTGGCAAGG - Intergenic
1182329781 22:29543046-29543068 ATAAAGAAGGGGATGGGGCTGGG + Intronic
1182541296 22:31044103-31044125 CAAAAGAAGGTGCTGGGGGATGG - Intergenic
1183731765 22:39622364-39622386 ATTGAGTAGGTGGAGGGGGAGGG + Intronic
1184506020 22:44903150-44903172 AGAGAGAATGTGCTGGAGGAGGG - Intronic
1184538151 22:45101532-45101554 ACAGAGTGGGTGAGGGGGGAGGG - Intergenic
949494613 3:4619831-4619853 AGAGAGAAGGAGAGGGGAGAGGG - Intronic
950380896 3:12613907-12613929 GTCGAGAAGGTGATGGGAGTGGG + Intronic
951008305 3:17645896-17645918 ATAGAGTAGGAGATCGGGAAGGG - Intronic
951147192 3:19241942-19241964 TTAGAGAAGATGATCAGGGAAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952883655 3:38000287-38000309 AGAGAGGAGGAGATGGGGCAAGG + Intronic
953127808 3:40108898-40108920 ATAGAGAAAGTGGTGGGGTGTGG - Intronic
953635564 3:44660911-44660933 AGAGGGAAAGTGATGGGAGAGGG + Intergenic
954044223 3:47915762-47915784 ATAGAAAAGGTGTTGGAGGTGGG + Intronic
954212066 3:49103545-49103567 AGTGAGAAGGAGGTGGGGGAAGG - Intronic
954260030 3:49432058-49432080 AGCGAGAAGGGGATGGGGGAGGG + Intergenic
954557906 3:51532743-51532765 TTAGATAAGGTGATGAAGGAGGG + Intergenic
954613805 3:51959501-51959523 ATAGAGGAGGGGATGGAAGAAGG - Intronic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
955865285 3:63375570-63375592 ATAGAGTAGGGGCTGGGGGAGGG + Intronic
957019429 3:75108410-75108432 AGAGAGAAGGGGAAGGGGAAGGG + Intergenic
957026985 3:75193270-75193292 ATAGAGCAAGCTATGGGGGAAGG + Intergenic
957374638 3:79340155-79340177 TTATATAAGGTGATGGGGAAAGG - Intronic
957563303 3:81854051-81854073 ATGGAAAAGGGGATGAGGGATGG + Intergenic
957672946 3:83328656-83328678 AAAGGGAAGGGGAAGGGGGAGGG + Intergenic
957711221 3:83861348-83861370 AAAGAGAAGCTGATAAGGGATGG - Intergenic
957979867 3:87494704-87494726 AGAGAGAAAGGAATGGGGGAAGG + Intergenic
959080337 3:101794219-101794241 ATAGAGAAGCTGAAGGGGGGAGG + Intronic
959671841 3:108987432-108987454 ATAGATAAGAAGATGGGGAAAGG + Intronic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960183071 3:114605969-114605991 TTAGATAAGGTGATAAGGGAAGG + Intronic
960266089 3:115623155-115623177 ATTGAGAGGGTGATGGGGTGGGG - Intergenic
960287030 3:115841400-115841422 ATAGATAAGGTGCTGAGAGAAGG - Intronic
960409608 3:117306681-117306703 TGAGAGAAGGTGATCAGGGAAGG - Intergenic
960438617 3:117658839-117658861 CCAGAGAAGGAGATGAGGGAAGG - Intergenic
960531680 3:118772573-118772595 ATTGGGGAGGTGCTGGGGGAGGG - Intergenic
961126706 3:124425117-124425139 ATAGAGAAGGGTAGAGGGGAGGG + Intronic
961485995 3:127216924-127216946 CTAGAGAAAGTGAGGTGGGAAGG - Intergenic
961711789 3:128833739-128833761 GCAGAGAAGGTGTTGGGGCACGG + Intergenic
961836749 3:129667894-129667916 ATAGAGGAGTTGACGGGGTATGG + Intronic
962003340 3:131323494-131323516 AAAGAGAGGAAGATGGGGGAAGG - Intronic
962024730 3:131536008-131536030 ATAGAGAAGGGGTAGGGGAATGG + Intronic
962124510 3:132601565-132601587 ATAAAGAATGGGTTGGGGGAAGG + Exonic
962241725 3:133755882-133755904 ATAGAGACGGTGATGGGGGCAGG - Intronic
962811342 3:138961595-138961617 ATAAATACTGTGATGGGGGAAGG + Intergenic
962856633 3:139352013-139352035 ATAGGGTAGTTGATGGGGGGAGG + Intronic
963275600 3:143326635-143326657 TTAGAGAAGGTAGTTGGGGAAGG - Intronic
963325458 3:143857517-143857539 ATAGAGAAGGTAAAGAGGGTGGG - Intergenic
963508494 3:146217965-146217987 AGAGAGAAGGAGATGGGGAAGGG + Intronic
963982314 3:151552366-151552388 AGAGACAAGGTGTTGGGGCAAGG + Intergenic
965475210 3:169147767-169147789 AGAGAGAGAGAGATGGGGGATGG + Intronic
966458267 3:180142824-180142846 ATAGAGAAGGGGGTGGCGAAAGG - Intergenic
966470466 3:180283284-180283306 ATAGAGATGGGAATGGGGGATGG - Intergenic
966594036 3:181710935-181710957 AAAGTGCAGGCGATGGGGGAGGG - Intergenic
966920981 3:184611187-184611209 ATAGAGATGCTGATGGTGGCGGG - Intronic
966942184 3:184754264-184754286 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966942239 3:184754480-184754502 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967972841 3:195012077-195012099 AGAGAGAAGGTGTGGGGGGCCGG + Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969574882 4:8030962-8030984 ATAGACACAGTGCTGGGGGATGG - Intronic
970326591 4:14931308-14931330 ATGGAGAAGGAAATGGGGGGTGG - Intergenic
970456521 4:16227918-16227940 ATAGAGAATTTCATGGAGGATGG - Intergenic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
971579838 4:28322157-28322179 AAAAAGAAGGTGATGGAAGAGGG + Intergenic
972591560 4:40492935-40492957 ATAATGAGGGTGATGGAGGAGGG - Intronic
972769465 4:42183795-42183817 ATTGACAAGGTAATGAGGGAGGG + Intergenic
973078992 4:45966070-45966092 AGAGAGAAGCTGATAGTGGATGG - Intergenic
973680397 4:53312040-53312062 GGAGAGAAGGGGATGGGAGATGG + Intronic
973884544 4:55307151-55307173 AGAGAGAGGGTGGTGGGGGAAGG - Intergenic
973968365 4:56186516-56186538 AGAGAGATGGGGATGGGGTAGGG + Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974703824 4:65486270-65486292 ATAGAGAGGGAAATGGGGGTGGG - Intronic
974743711 4:66042232-66042254 ATTGAGATGGTGGTGGGGGGAGG + Intergenic
975189220 4:71440113-71440135 TTAGACAGGGTGATAGGGGAAGG - Intronic
975360243 4:73460988-73461010 AAAGGGAGGGAGATGGGGGAGGG - Intergenic
975612055 4:76213413-76213435 ATCGAGAAGGTGAGGCGGGGCGG - Exonic
975696663 4:77020752-77020774 ATTGAGATGGTGATGATGGAAGG + Intronic
976406966 4:84670856-84670878 TTGAAGATGGTGATGGGGGAGGG + Exonic
978268555 4:106859031-106859053 AAAGGTAAGGGGATGGGGGAGGG + Intergenic
979019553 4:115478887-115478909 AGAGACAAGGTGTTGGGGCAAGG + Intergenic
979234138 4:118380587-118380609 ACAGAGAAGTTTAAGGGGGAAGG - Intergenic
979305233 4:119134875-119134897 TTAGACAAGGTGATAAGGGAAGG + Intergenic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
979448828 4:120844612-120844634 AGAGAGAGAGAGATGGGGGAAGG - Intronic
980896995 4:138869153-138869175 AGAGAGAGGGTGAGGGGAGAGGG + Intergenic
981538841 4:145827303-145827325 ATAGAGAAGGGGGTGATGGAGGG + Intronic
981576221 4:146208556-146208578 ACAGAAAAAGTGATGTGGGATGG - Intergenic
981746086 4:148053643-148053665 ATAGACAATGTGATGGTAGATGG - Intronic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
982147747 4:152415927-152415949 AAAGAGAAGGTGATGCTGGGGGG - Intronic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
984719687 4:182958064-182958086 AAGGAGGGGGTGATGGGGGAAGG + Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984951396 4:185010463-185010485 ACAAAGAAGGAGATGGGGAAGGG + Intergenic
986185575 5:5433347-5433369 TTTGAGAAGGTGAAGGGGAATGG - Intronic
986733869 5:10653980-10654002 AGAGACAAGGTGACGGGGGCAGG - Intergenic
988379204 5:30478784-30478806 ATAGAAAAGATGAAGGGAGAGGG - Intergenic
988502641 5:31796395-31796417 ATAGAGAAGTTGATCGGTGGCGG - Intronic
988654948 5:33200499-33200521 ATATTGAAGGAGATGGGGAAAGG - Intergenic
988857883 5:35246988-35247010 AGAAAGAAGGAAATGGGGGAAGG + Intergenic
990050310 5:51491785-51491807 AGAGAGAAAGTGCTGGGAGAGGG + Intergenic
990733651 5:58836533-58836555 ATTGAGAAGGGTGTGGGGGAAGG - Intronic
991005189 5:61821982-61822004 ATAGTGAAGGTGGTCAGGGAAGG + Intergenic
991349342 5:65704749-65704771 ATTGAGATGGTGATTAGGGAGGG - Intronic
992777173 5:80098599-80098621 ATAGAGCAGGGGTTGGGGGCAGG - Intergenic
992877722 5:81074312-81074334 ATAAAGAAGGGAATGGGAGAAGG + Intronic
993487302 5:88502703-88502725 ATATAGAATGGGATGGGGGTGGG + Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995970712 5:117966991-117967013 ACAGAGAAGGTGATAGAGCAAGG + Intergenic
996484876 5:124021202-124021224 ATAGAGAAGTGGGTGGGGGAAGG - Intergenic
996567638 5:124897007-124897029 ATAGAAAAGGTGAAGGGGCCGGG + Intergenic
996602344 5:125278988-125279010 ATAGTGGAAGAGATGGGGGAAGG - Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997462517 5:134063383-134063405 ATAGAGACAGGGATGGGGGTAGG - Intergenic
997611505 5:135218696-135218718 ATAGAGAATGGGATGAGAGAGGG - Intronic
998023047 5:138787498-138787520 AAAGAAATGGTCATGGGGGATGG + Intronic
998385397 5:141754411-141754433 AAAGAGAAGGTTATGGGCCAAGG + Intergenic
999049786 5:148509939-148509961 ACAGAGCAGGTGATGGCGTAGGG + Exonic
999655241 5:153804490-153804512 ATAGAGAAGGTTTTGAGGGATGG - Intronic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
999995619 5:157089642-157089664 ATAGAGAGGGTGGTCAGGGAAGG + Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000193563 5:158936970-158936992 AAAGAGAGGGTCATGGAGGAGGG + Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000531048 5:162420280-162420302 GGAGAGAGGGAGATGGGGGAAGG + Intergenic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001294703 5:170490803-170490825 AGAGAGAAGGGGATGGGGCTGGG - Intronic
1001426375 5:171625380-171625402 ATAGTGGATGTGGTGGGGGAGGG - Intergenic
1001951617 5:175820480-175820502 GGAGACAAGGTGATGCGGGAGGG - Intronic
1002026002 5:176396722-176396744 TTAGAGAAGGTGCTGGGGCCAGG - Intronic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1003507604 6:6752437-6752459 AGAGAGCAGGGGCTGGGGGATGG + Intergenic
1003548706 6:7083218-7083240 ATGGAGAAAGTTATGTGGGAGGG - Intergenic
1003602891 6:7534268-7534290 ATAGAGCAGGAGCTGGGGGAAGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004020961 6:11775226-11775248 GTAGAGAAGGTGATGCAGGAGGG - Intronic
1004702526 6:18092566-18092588 GTAGAGATGGTGGTGGAGGATGG + Intergenic
1004775982 6:18845261-18845283 ATGGAGAAGGAGATGGGGTGAGG + Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005399371 6:25415851-25415873 ATGGAGAAGGGGCTGGGGAATGG + Intronic
1005429155 6:25736102-25736124 AAAGAGAAGGTGGTGGGGGTGGG + Intergenic
1005763677 6:28989884-28989906 GAAGAGAAGGAGATGAGGGAAGG - Intergenic
1005808493 6:29497460-29497482 AGAGAGAGAGTGAAGGGGGAAGG - Intergenic
1005852343 6:29830901-29830923 ACAGGAAAGGTGATTGGGGAAGG - Exonic
1005875971 6:30009733-30009755 ACAGGAAAGGTGATCGGGGAAGG - Intergenic
1005967215 6:30735278-30735300 CTAGAGGATGTGATGGGGGCTGG - Intronic
1006084307 6:31585590-31585612 ATGGAGAAGGAGATGGGTGCTGG - Intergenic
1006576226 6:35048467-35048489 AGGCAGAAGGGGATGGGGGAGGG - Intronic
1006699621 6:35961493-35961515 ATGGAGAAGGTGCTGGGGTAGGG - Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007128175 6:39445220-39445242 ACAGAGAAGATGAAGGGGCAGGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007791241 6:44309851-44309873 TTAGATAAGGTGCTTGGGGAAGG - Intronic
1007811750 6:44491196-44491218 GTAGAGAAGGGGATGGGGCTGGG + Intergenic
1008174970 6:48256833-48256855 ATAGAAGAGGTGATTGGGGCAGG + Intergenic
1008321365 6:50118310-50118332 ATAGAGAAAAGGTTGGGGGAAGG - Intergenic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009206871 6:60812578-60812600 AAAGAGAAGGAGGTGGGGGGAGG + Intergenic
1010570025 6:77464373-77464395 AAAGGGAAGGTGATGGGGAGCGG - Intergenic
1010773491 6:79859248-79859270 AGAGACAAGGTGTTAGGGGAAGG - Intergenic
1010885695 6:81237099-81237121 ATGGAGAAGGAGATGGGTTATGG + Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1012819013 6:104061375-104061397 AGAGAGAAGGGGTTGGGGAAAGG + Intergenic
1012953314 6:105541657-105541679 CTAGAGAAAGGTATGGGGGAAGG - Intergenic
1014344799 6:120254614-120254636 AAAGAGGAGGAGATGGGGGAGGG + Intergenic
1014814349 6:125918928-125918950 TTAAAGAAGGTGCTGGGGGCGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015394377 6:132718285-132718307 ATAGAGCAAGGTATGGGGGAAGG + Intergenic
1015479215 6:133689699-133689721 ATGGCGAGGGTGATGGGGGCAGG + Intergenic
1015814244 6:137191690-137191712 CCAGAGATGGTGAAGGGGGAAGG + Intergenic
1015979419 6:138823914-138823936 ATAAAGAATGGGTTGGGGGAAGG + Intronic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016656518 6:146524563-146524585 GTAGAAAATGTTATGGGGGATGG + Intergenic
1016920726 6:149290367-149290389 ATAGAGAATGTGCGGGGTGAAGG - Intronic
1017054921 6:150428005-150428027 ATAGAGTAGGGGAGGTGGGAGGG + Intergenic
1017658729 6:156653809-156653831 TTAGATAGGGTGGTGGGGGAAGG - Intergenic
1017754549 6:157518381-157518403 ATAGGGAAGGGGTGGGGGGAGGG + Intronic
1018088332 6:160324455-160324477 ATAAAGAAGGTGGTGGGCCAAGG + Intergenic
1018441098 6:163814110-163814132 AAAGAGAAAGTGGTGGGGAAGGG - Intergenic
1018699585 6:166416084-166416106 ATGGTGGAGGTGATGGAGGAAGG - Intronic
1018744922 6:166754577-166754599 ATAAAGGAGGTGGTGGGGGTGGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019414141 7:919772-919794 AGAGGGAGGGAGATGGGGGAGGG + Intronic
1019923492 7:4177686-4177708 ATAGACCAGGTGGTAGGGGATGG + Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020724346 7:11791387-11791409 AAAAAGAAGGTAATGGGGTAGGG - Intronic
1021450614 7:20780353-20780375 AGAGAGAAGGTGAGGAAGGAAGG + Intergenic
1021545956 7:21812992-21813014 ATACTGAAGGGTATGGGGGAAGG + Intronic
1021739592 7:23672598-23672620 AAATAGAATGTGATGGAGGAGGG + Intergenic
1021847592 7:24778065-24778087 AGAGAGAAAATGGTGGGGGAGGG + Intergenic
1022098354 7:27154733-27154755 CTGGAGTAGGTGATGGGGGTGGG + Exonic
1022106839 7:27202648-27202670 AGAGGGATGGTGCTGGGGGAAGG + Intergenic
1022159254 7:27692430-27692452 GTAGAGATGGAGTTGGGGGAGGG - Intergenic
1022685618 7:32593614-32593636 ATAAAGAAAGTGATGGGGCTGGG + Intergenic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1023882869 7:44330309-44330331 ATAGAGAAAGGGAGGGGGAATGG + Intronic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024702245 7:51916746-51916768 AGAGAGAGAGTGAAGGGGGAAGG + Intergenic
1025274569 7:57566379-57566401 ATAGAAAGGGTGAAGGGGTAAGG - Intergenic
1025988064 7:66473520-66473542 ATAGAGAATTTCATGGAGGATGG + Intergenic
1026176503 7:68002359-68002381 ATAGATAAGGTGATTAGGAAGGG - Intergenic
1026455642 7:70570309-70570331 ACAGACAAGATGCTGGGGGAAGG - Intronic
1026562883 7:71464913-71464935 AGAGACAAGGTGTTGGGGCAAGG + Intronic
1026638662 7:72105831-72105853 ATAGGGATGGGGATGAGGGAGGG + Intronic
1026837546 7:73648435-73648457 AGAGAGAAAGTGAGGGGAGAGGG - Intergenic
1027211049 7:76149417-76149439 ATAGAGAATTTCATGGAGGATGG + Intergenic
1027355149 7:77347139-77347161 ATAGAGTGGGGTATGGGGGAAGG - Intronic
1028637673 7:93007850-93007872 ATGGAGATGGTGATGGGGCAGGG - Intergenic
1028921488 7:96314994-96315016 TCAGAGAAGGTGCTGGAGGAGGG - Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029805395 7:102990767-102990789 AGAGAGCACGTGATGGGTGAAGG + Intronic
1030215227 7:107037985-107038007 ATAGAGAAGGGGCTGGAGGGTGG + Intergenic
1030295490 7:107921851-107921873 ATGGACAAGGGGATGGGGGTGGG - Intronic
1031339813 7:120585299-120585321 AAACAGAAGGGGATGGGGGGTGG + Intronic
1031425772 7:121603815-121603837 ATAAAGAAGGCTAAGGGGGATGG - Intergenic
1031467968 7:122136864-122136886 ACAAAGAAGGTGGTGGGAGAAGG - Intronic
1031957217 7:127954808-127954830 AAAGAGCAGGTGATGGGAGGTGG + Intronic
1032310725 7:130784301-130784323 GTTCAGAAGGTAATGGGGGAAGG + Intergenic
1032577523 7:133071369-133071391 AAAGAGAAGGTGGGGAGGGAAGG + Intronic
1033348378 7:140542500-140542522 AGAGAGAGGAAGATGGGGGAGGG - Intronic
1033472919 7:141665327-141665349 ATAGAGGAGGTGAGCGGGGAGGG + Intronic
1033590174 7:142802229-142802251 ATAGGGCAGATGATGGGGGCAGG + Intergenic
1033804372 7:144937544-144937566 AAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1034088710 7:148344410-148344432 ATAGAGGAGGTGATTGGAGAAGG - Intronic
1034328250 7:150257826-150257848 ATAAAGAATGTGCTGGGAGAGGG + Intronic
1034448694 7:151126195-151126217 GCAGAGAATGTGATCGGGGAGGG - Intronic
1034764966 7:153711638-153711660 ATAAAGAATGTGCTGGGAGAGGG - Intergenic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035494422 7:159310774-159310796 ACAGAAAAGCTGATGGGGGTGGG + Intergenic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1035913620 8:3595932-3595954 AAAGAGAAGAAGATGGGAGAGGG - Intronic
1036125380 8:6057422-6057444 ATGGGGGTGGTGATGGGGGATGG - Intergenic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037127949 8:15372883-15372905 ATAGAGTGGATGATGGAGGAGGG - Intergenic
1037658860 8:20910197-20910219 ATAGGGGAGGTGCTGGGGGTAGG + Intergenic
1037674244 8:21040713-21040735 ATAGAGACAGAGATGAGGGAGGG - Intergenic
1038897373 8:31800268-31800290 ATAGAGCAGGTGGTGGGGCGAGG + Intronic
1039087999 8:33799044-33799066 AAGGAGAAGGTCATGGAGGAGGG + Intergenic
1039478692 8:37855777-37855799 GTAGAGATGGTGGTGGGGGGCGG + Intergenic
1041011618 8:53549444-53549466 ATAGAGGAGGTGGTGGGAGTGGG - Intergenic
1041173748 8:55171846-55171868 ATAGTGCAGGTGATGGACGATGG - Intronic
1041314175 8:56544513-56544535 ATAGAGGAGGTGGTGGGAGTAGG - Intergenic
1042252308 8:66769127-66769149 ATAAAGATGGTGTTGGAGGATGG - Intronic
1042274758 8:66992703-66992725 ATAGAGAAGGCAATGGGTTACGG - Intronic
1042816555 8:72883654-72883676 AAAGAGAATGGGATTGGGGAGGG - Intronic
1043112296 8:76201140-76201162 ATAGAGGAAGTGATGGGGATGGG + Intergenic
1043313017 8:78886101-78886123 AGAGAGAGGGAGTTGGGGGATGG - Intergenic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1044609206 8:94075690-94075712 TGAGAGAAGGTGACGGGTGATGG - Intergenic
1044741608 8:95332821-95332843 ATAGAGGAGGGGTTGGGGGAAGG + Intergenic
1044806784 8:96016600-96016622 AGAAAGTAGGGGATGGGGGAAGG + Intergenic
1046915566 8:119674730-119674752 CTAGAGAAGGGGGTGCGGGATGG + Intergenic
1047301381 8:123616371-123616393 AGAGTGAAGGGGATGGGGGTAGG + Intergenic
1047344139 8:124010747-124010769 ATTGGGAAGCTGGTGGGGGAAGG + Intronic
1047508255 8:125496766-125496788 ATAGAGGAGGACATGGGAGAAGG + Intergenic
1048002714 8:130392788-130392810 TGAGAGAAGGAGGTGGGGGAGGG + Intronic
1048416473 8:134232697-134232719 AGAGAGAAGGTGAGGGAGAATGG - Intergenic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1049350591 8:142162443-142162465 AAAGAGATGAAGATGGGGGATGG + Intergenic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350878 8:142163993-142164015 AGAGAGATGGAGATGAGGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049519465 8:143080651-143080673 GGAGAGAAGGTGCTGGGAGAGGG + Exonic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051755446 9:20394892-20394914 AAAAAGAAGTTGGTGGGGGAGGG - Intronic
1052280225 9:26724364-26724386 ATACAGAAGGTGAAGAGGAAAGG - Intergenic
1053000866 9:34576785-34576807 GAAGAGAGGGTGATGAGGGAAGG - Intronic
1053157778 9:35792253-35792275 ATGCAGAAGGTGCTGGGGGCCGG - Exonic
1053329196 9:37188564-37188586 GTAGGGGAGGTGAGGGGGGAGGG - Intronic
1053329324 9:37188841-37188863 AAAGAGAAGGGGAGGGGAGAGGG - Intronic
1053452214 9:38202710-38202732 AGAGAGAATGTTGTGGGGGAGGG - Intergenic
1053510145 9:38680728-38680750 AGAGAGAAGGGGTTGGAGGATGG + Intergenic
1054849018 9:69827535-69827557 ATACAGATGGTAGTGGGGGAAGG - Intronic
1054879914 9:70134323-70134345 ATGGAGAAGGAAGTGGGGGATGG - Intronic
1055312564 9:74998200-74998222 ATGAACAAGGTGATTGGGGATGG - Intronic
1055418052 9:76105724-76105746 ATAGATATGGTGGTGGGGGAAGG - Intronic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1058782442 9:108351889-108351911 ATACAGAAGGAGATAGGTGAGGG - Intergenic
1059589447 9:115642353-115642375 AAAGAAAAGGAGGTGGGGGAGGG - Intergenic
1059917487 9:119119609-119119631 AGAGGGAAAGAGATGGGGGAAGG - Intergenic
1059945257 9:119403055-119403077 GTACAGAAGGTGATGTGGGGAGG - Intergenic
1060228879 9:121812717-121812739 GGAGAGAAGGTGATGGGGGCGGG + Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1061658503 9:132111479-132111501 GTAGAGACGGTGGTGCGGGAGGG - Intergenic
1061926619 9:133809026-133809048 ATTGAGAAGGTGAGGGCAGATGG - Exonic
1062493924 9:136822650-136822672 TTTGAAAATGTGATGGGGGAGGG - Intronic
1185936455 X:4262342-4262364 ATAGAGGAAGATATGGGGGAAGG + Intergenic
1186574093 X:10746997-10747019 ATGGAGAAGGTGAGAGGTGATGG + Intronic
1186677594 X:11835380-11835402 AGAAAGAAGGAGATGGAGGAGGG - Intergenic
1186726533 X:12364619-12364641 ATAGAGATGGTGAGGGAGGCAGG + Intronic
1187362753 X:18643366-18643388 ATAGAGAGGGTGGTGTGGGGCGG - Intronic
1187505386 X:19874755-19874777 AAAGAGAAGGTGTGGGGAGAAGG + Intronic
1187796475 X:23008952-23008974 ATATAGTAGGTGATGGGAGAGGG - Intergenic
1187928120 X:24268975-24268997 GAAGAAAAGGTGTTGGGGGAAGG - Intergenic
1188369606 X:29352609-29352631 AAAGAGATGGGGATGGGGGGTGG - Intronic
1188438652 X:30192327-30192349 AGAGAGAAGGGGATGAAGGACGG - Intergenic
1188534054 X:31175761-31175783 AAAGAGAAGGTGGTGGTGGGTGG - Intronic
1189267440 X:39727918-39727940 AAGGAGAAGGTGCTGGGGGATGG - Intergenic
1189384924 X:40529455-40529477 ATGGTGGAGGTGGTGGGGGATGG - Intergenic
1189683455 X:43540092-43540114 AAAAAGAAAGTGACGGGGGAGGG + Intergenic
1190161969 X:48038703-48038725 AGAGTGAAGGTGATGCTGGAGGG + Intronic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1190775253 X:53547477-53547499 AGAGAGACGGGGATGGAGGAAGG + Intronic
1190823349 X:53994891-53994913 AGAGAGAAGTTGGTGTGGGATGG - Intronic
1191019442 X:55843427-55843449 ATGGAGAAGGGCATGGGGAAAGG - Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1192268241 X:69555324-69555346 ATAGAGAATGTGGCTGGGGATGG + Intergenic
1192279515 X:69669818-69669840 TTAGAGAAGGGAATGGGGTAGGG - Intronic
1192656467 X:72999891-72999913 AAAGAGAGGGTGCTGGGGGTGGG - Intergenic
1192665653 X:73083110-73083132 AAAGAGAGGGTGCTGGGGGTGGG + Intergenic
1193681708 X:84528051-84528073 AGAGAGTAGGGGATGGGGAATGG + Intergenic
1194841040 X:98742454-98742476 GTAGAGAAGGACATGGTGGAAGG - Intergenic
1195031614 X:100932098-100932120 ATAGAGAAGTTGGTGGGTGAGGG - Intergenic
1195652297 X:107297766-107297788 AGAGAGAGAGAGATGGGGGAGGG - Intergenic
1196697809 X:118632946-118632968 AGAGAGAAGGTGGTGGGGGGCGG + Intronic
1197088422 X:122507888-122507910 AAAGAGAAGGTGGTGGTGGGGGG - Intergenic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197720604 X:129742273-129742295 ATAGAGAAGATGATAGAGCAGGG - Intronic
1197765302 X:130056180-130056202 AAAGACAAGGAGGTGGGGGAAGG - Exonic
1197837921 X:130714851-130714873 GGAGAGAAGGTGGTGGAGGAGGG + Intronic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198394621 X:136208952-136208974 AGAAAGAAGGGGGTGGGGGAGGG + Intronic
1198466738 X:136910204-136910226 AAAGAGAAGGAGATGGGAGAGGG - Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199710337 X:150464642-150464664 AGAGACAAAGAGATGGGGGATGG - Intronic
1199873246 X:151915222-151915244 AAAGGGGACGTGATGGGGGATGG - Intronic
1199873773 X:151917266-151917288 AAAGGGGACGTGATGGGGGATGG - Intronic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1199949746 X:152698602-152698624 ATGAAGATGGTGATGGGGCAAGG - Intergenic
1199959928 X:152769859-152769881 ATGAAGATGGTGATGGGGCAAGG + Intergenic
1200303821 X:155005436-155005458 ATTGAGAGGGTGGTGGGGGGAGG + Intronic
1201452431 Y:14130576-14130598 GAAGAGAAGGTGAAGAGGGAAGG - Intergenic