ID: 1128376045

View in Genome Browser
Species Human (GRCh38)
Location 15:67076767-67076789
Sequence CAGGCTCAAGACACTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128376045_1128376046 -5 Left 1128376045 15:67076767-67076789 CCTGCATCAGTGTCTTGAGCCTG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1128376046 15:67076785-67076807 GCCTGTTTCCAAGTCCTGCGTGG 0: 1
1: 0
2: 3
3: 13
4: 106
1128376045_1128376056 26 Left 1128376045 15:67076767-67076789 CCTGCATCAGTGTCTTGAGCCTG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1128376056 15:67076816-67076838 CCCAGGTCTGTTTTACTTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 172
1128376045_1128376051 9 Left 1128376045 15:67076767-67076789 CCTGCATCAGTGTCTTGAGCCTG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1128376051 15:67076799-67076821 CCTGCGTGGGCCTCTTCCCCAGG 0: 1
1: 0
2: 5
3: 36
4: 294
1128376045_1128376048 -4 Left 1128376045 15:67076767-67076789 CCTGCATCAGTGTCTTGAGCCTG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1128376048 15:67076786-67076808 CCTGTTTCCAAGTCCTGCGTGGG 0: 1
1: 0
2: 1
3: 15
4: 108
1128376045_1128376054 25 Left 1128376045 15:67076767-67076789 CCTGCATCAGTGTCTTGAGCCTG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1128376054 15:67076815-67076837 CCCCAGGTCTGTTTTACTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128376045 Original CRISPR CAGGCTCAAGACACTGATGC AGG (reversed) Intronic
900718832 1:4161980-4162002 CTGCCTCAAGTCACTCATGCAGG + Intergenic
900792075 1:4687399-4687421 CAGCCTCAAAGCACTGATTCAGG + Intronic
903595579 1:24491438-24491460 CAGGCACAAGCCACTGCTCCTGG + Intergenic
904212716 1:28896675-28896697 CAGGCTCAAGACAATGAGTGAGG + Intronic
905207040 1:36348861-36348883 CAGGCACAAGACACGCAGGCAGG + Intronic
907223188 1:52921900-52921922 CAGGATTAAAACACTGACGCTGG - Intronic
909028403 1:70509679-70509701 CAGGCTTAAGCCACTGAGACTGG + Intergenic
909486183 1:76176930-76176952 CAGGCTCAAGCCACTGCACCAGG - Intronic
911193627 1:94972229-94972251 CAGGCTCGGGCCACTGAGGCAGG + Intergenic
911258238 1:95657137-95657159 TAGCATGAAGACACTGATGCAGG + Intergenic
912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG + Exonic
912839134 1:113023529-113023551 TAGTCTCAAGAGGCTGATGCAGG - Intergenic
914858856 1:151370669-151370691 CAGGCCCCAAACTCTGATGCTGG - Intronic
915874918 1:159602260-159602282 CAGGAGCAAGACAGTGAGGCGGG - Intergenic
917036579 1:170753799-170753821 AAGGATCAAATCACTGATGCAGG + Intergenic
917202955 1:172536608-172536630 CAGGCATAAGAAACTAATGCAGG - Intronic
919134605 1:193492081-193492103 CAGGTTCAAGACATGGACGCTGG + Intergenic
922729828 1:227943837-227943859 CAGGCACAAGCCACTAATCCTGG - Intronic
923200117 1:231703344-231703366 CGGGCTGAAGCCACTGACGCTGG - Intronic
923641031 1:235760974-235760996 CAGGCTCAAGCCACTGCACCTGG - Intronic
924698322 1:246423421-246423443 CAGGCACAAGCCACTGCTCCTGG - Intronic
1062806467 10:423756-423778 AAGGATCAAGACACTGATGATGG + Intronic
1063983230 10:11473389-11473411 CAGGCACAAAACACAGGTGCAGG + Intronic
1065588550 10:27242307-27242329 CAATCTCAAGACACTTAAGCTGG - Intergenic
1066617894 10:37314412-37314434 CAGTCTCAGGACACTGTTGATGG + Intronic
1067050810 10:43019153-43019175 CAGGCACAAGCCACTGTGGCTGG - Intergenic
1067916352 10:50403691-50403713 GAGGCTCAATACACTGATGAAGG + Intronic
1068524565 10:58113494-58113516 CAGGCGCAAGCCACTGAGCCTGG - Intergenic
1069376914 10:67802139-67802161 CAGGCCCAAGCCACTGCAGCTGG + Intronic
1069711331 10:70490726-70490748 CAGGCCCAAGAAACAGAGGCAGG - Intronic
1071303187 10:84273235-84273257 CAGGCTCAAGTCACTGCACCCGG - Intergenic
1071680497 10:87700513-87700535 CAGGCACAAGCCACTGTGGCTGG - Intronic
1072933286 10:99687190-99687212 CAGGCGCAAGCCACTGCGGCCGG + Intronic
1075118643 10:119648302-119648324 CAGGCCCCAGGGACTGATGCAGG - Intergenic
1075545211 10:123350134-123350156 CAGGGCCAGGACACTGACGCTGG + Intergenic
1076871144 10:133195746-133195768 CAGGCTCAAGACCCTCCTCCTGG + Exonic
1077889035 11:6405532-6405554 CAGTCCCAAGACCCTGCTGCTGG + Intronic
1077918738 11:6627385-6627407 CAGGCTCATGACCCTGATGCTGG - Exonic
1078132762 11:8626312-8626334 CAGGTTCAAGACACTGATTTTGG - Intronic
1078530050 11:12130336-12130358 CAGGCTCCAGGCAGTGATTCTGG - Intronic
1079731538 11:23941173-23941195 CAGACTAAAGACACGGTTGCAGG - Intergenic
1081466736 11:43326225-43326247 CAAGGTCAAGACACTTTTGCAGG - Intronic
1081974681 11:47225215-47225237 CAGGCTTGAGACACTGCTCCTGG + Intronic
1083085676 11:60142252-60142274 CAGGCACAAGCCACTGCTCCTGG + Intergenic
1084417031 11:69038457-69038479 CAGGCACAAGCCACTGCTCCCGG - Intergenic
1084703682 11:70803710-70803732 CTGGCTCAGGAGCCTGATGCTGG + Intronic
1086732262 11:90264897-90264919 TTGGTTCAAGAAACTGATGCAGG - Intergenic
1087123743 11:94601657-94601679 CAGTCTTAAAACACAGATGCAGG - Intronic
1087811579 11:102614007-102614029 CAAGCTCCAGACCCTGATTCGGG - Intronic
1091157777 11:133389759-133389781 CAGGCTCCATACATAGATGCAGG + Intronic
1092882450 12:12898253-12898275 CAGGCACAAGCCACTGCTCCTGG - Intronic
1092903877 12:13084806-13084828 CATGCTCAAGAGACGGATGTTGG + Exonic
1095043119 12:37466469-37466491 CAGGCTCAAGCCACTGCTCAGGG - Intergenic
1102787445 12:115616367-115616389 CAGGTTCAAGAGGCTGCTGCAGG - Intergenic
1103268433 12:119650918-119650940 CAGGCACAAGCCACTGCTCCCGG + Intergenic
1106161926 13:27209113-27209135 CAGGCACAAGCCACCAATGCCGG + Intergenic
1107741818 13:43458663-43458685 AGGGGTCAAGAAACTGATGCTGG - Intronic
1108487711 13:50943829-50943851 CAGGGTCTGGACACTGATGAGGG + Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112775583 13:102840453-102840475 AAGACTCAAGAAACTGATCCTGG + Exonic
1113335119 13:109370028-109370050 CACGCTCAGGACACTGCTGGAGG - Intergenic
1114033481 14:18597284-18597306 CAAGCTCTACTCACTGATGCTGG - Intergenic
1114078271 14:19176484-19176506 CAAGCTCTACTCACTGATGCTGG - Intergenic
1117635231 14:57735990-57736012 CAGGCACAAGTCACTGTTCCTGG + Intronic
1118191265 14:63582788-63582810 CATGCTCAGGAGACTGAGGCAGG + Intergenic
1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG + Intergenic
1123503474 15:20913701-20913723 AAGGCTGAAGATACTGATGGCGG + Intergenic
1123560721 15:21487366-21487388 AAGGCTGAAGATACTGATGGCGG + Intergenic
1123596960 15:21924662-21924684 AAGGCTGAAGATACTGATGGCGG + Intergenic
1126758340 15:51946299-51946321 CAGCCTCAGGAGACTGAGGCAGG - Intronic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1129000933 15:72333213-72333235 CAGGCACAAGCCACTGAGCCTGG + Intronic
1129139238 15:73582114-73582136 CAGGCTCAAGACACTGCGCCTGG + Intronic
1129219322 15:74122245-74122267 CAGGCCCCAAACTCTGATGCTGG + Intronic
1129612034 15:77068751-77068773 CATCCTCAACAAACTGATGCAGG - Intronic
1131375384 15:91918813-91918835 AAGTCTCAAGGGACTGATGCTGG + Intronic
1202969068 15_KI270727v1_random:214530-214552 AAGGCTGAAGATACTGATGGCGG + Intergenic
1132710906 16:1266847-1266869 CAGCCTCAGGACACTGATACGGG + Intergenic
1134440050 16:14294059-14294081 CAGGCTCCAGCCACTGCTCCCGG - Intergenic
1134549884 16:15134032-15134054 CAGCAACAAGACACTGGTGCTGG - Intronic
1134956168 16:18383196-18383218 CAGCAACAAGACACTGGTGCTGG - Intergenic
1139474940 16:67198463-67198485 CAGAAGCAAGACACTGAGGCTGG - Exonic
1140198282 16:72874152-72874174 CAGGCACAAGAAAGTGAGGCTGG - Intronic
1140581645 16:76237933-76237955 CAAGCAAAAGAAACTGATGCTGG - Intergenic
1141605428 16:85150403-85150425 AAAACGCAAGACACTGATGCTGG + Intergenic
1142706471 17:1698094-1698116 CAGGCTCGAGCCACTGAGCCCGG - Intergenic
1145079025 17:19879330-19879352 CAGGCTCAAGCCACTGCACCTGG + Intergenic
1145936049 17:28715485-28715507 CAGGTTGAAGACAATGATGATGG + Exonic
1146612439 17:34319667-34319689 AAGGCTCAGGTCACTGAGGCTGG + Intronic
1147769663 17:42858761-42858783 CAGACTCAAGACAGAGATGCAGG + Intergenic
1149143913 17:53466784-53466806 CAAGCTGAAGAGACTCATGCAGG - Intergenic
1149796851 17:59528837-59528859 CAGGCATAAGCCACTGATCCTGG + Intergenic
1149955660 17:61046456-61046478 GATGCTCAAGTCCCTGATGCTGG + Intronic
1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG + Intronic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1151689807 17:75675635-75675657 CAGGCACAAGTCACTGTGGCCGG - Intronic
1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG + Intronic
1153566271 18:6421033-6421055 CAGGCTCAGGAGGCTGATGTGGG - Intergenic
1155747186 18:29370996-29371018 CAGGCTTAAGACACTGCATCTGG + Intergenic
1156136722 18:34049135-34049157 AAGGCTCCAGACGTTGATGCTGG - Intronic
1156157019 18:34315119-34315141 CTGGCTCAAGTCTCTGATGATGG - Intergenic
1156408304 18:36804103-36804125 CAGGCTCATGCCACTGCTCCCGG + Intronic
1159050560 18:63417597-63417619 CAGCCTTAAGTCACTGATGTAGG - Intronic
1159367270 18:67484377-67484399 CAGCTTTAAGACACTGAGGCTGG - Intergenic
1159899825 18:74035797-74035819 GAGGCTGAAGACACTCATGAAGG + Intergenic
1161598483 19:5165231-5165253 CAGACTAAAGACACTGGTGTCGG - Intronic
1161806947 19:6449809-6449831 CAGGCACAAGCCACTGCTCCTGG + Intronic
1162224367 19:9207879-9207901 CAGCCTCTAAACACTGAGGCAGG - Intergenic
1164707466 19:30330976-30330998 CAGGCTCAAGTCATTGATACTGG + Intronic
1164925956 19:32130112-32130134 CAGGCTTAAGCCACTGAGCCTGG + Intergenic
1166109063 19:40611766-40611788 CAGGCTCAAGACTGGAATGCTGG + Intronic
1166384311 19:42371647-42371669 CAGGCCCTAGGCAGTGATGCTGG + Intronic
1167014727 19:46833497-46833519 CAGGCGCAAGCCACTGAACCTGG - Intergenic
925118770 2:1401702-1401724 CTGGCAGAAGACACTGAGGCAGG - Intronic
926190760 2:10725800-10725822 CAGGCTCAAGCCACTGCACCCGG - Intronic
926267140 2:11334233-11334255 CAGGCTCAAGTCACTGCGCCTGG - Intronic
926467204 2:13205869-13205891 CAGCCTCAGGACACTGCTCCTGG + Intergenic
927204379 2:20597934-20597956 CTGGCTCTAGGCACTGAGGCAGG - Intronic
928003594 2:27542996-27543018 CAGGTTCAAGCCACTGAGCCTGG - Intronic
929585580 2:43112192-43112214 CAAGCTCAAGACACTCCTGTGGG + Intergenic
930682551 2:54272407-54272429 TATGCACAAGACACAGATGCAGG - Intronic
930968948 2:57370336-57370358 CAGGCACAAGTCACTGAGCCTGG + Intergenic
931961630 2:67489338-67489360 CAGGCACAAGCCTCTGCTGCTGG + Intergenic
932732510 2:74231272-74231294 CAGGATGAAGACGATGATGCCGG + Exonic
937713884 2:125010103-125010125 CAGACTAAAGACAATGATGAAGG - Intergenic
940544877 2:155071100-155071122 AAGGCTCAAGAAACTGGTGAGGG + Intergenic
940570881 2:155431413-155431435 CAGGCGCAAGCCACTGCTTCCGG + Intergenic
940717969 2:157249350-157249372 CAGGCTCAAAACATTGAGGGAGG - Intergenic
948250427 2:236524086-236524108 CAGGGTCAAGACCTTCATGCTGG - Intergenic
948266329 2:236637733-236637755 CTTGTTCCAGACACTGATGCTGG - Intergenic
949081580 2:242104913-242104935 CTGGCTCTGGTCACTGATGCAGG - Intergenic
1169120706 20:3093937-3093959 AAGGCTTAAAACAGTGATGCTGG - Intergenic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1172459740 20:35108385-35108407 CAGGCTTAAGCCACTGTTCCTGG + Intergenic
1173604467 20:44321391-44321413 CAGGCACAAGACACTGCACCTGG + Intergenic
1174378980 20:50144406-50144428 CAGGCTCCAGACAATGAGTCAGG + Intronic
1176300884 21:5098420-5098442 CTGGCTCCAGGCACTGTTGCAGG - Intergenic
1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG + Intronic
1179161470 21:38903067-38903089 CAAGCTCAATACATTGATCCAGG + Intergenic
1179856152 21:44163533-44163555 CTGGCTCCAGGCACTGTTGCAGG + Intergenic
1180457596 22:15524343-15524365 CAAGCTCTACTCACTGATGCTGG - Intergenic
1181953344 22:26570685-26570707 CAGGCTCAACACCCAGGTGCAGG - Intronic
1185249952 22:49795980-49796002 CAGGCTCCAAACAGTGCTGCTGG - Intronic
951157147 3:19369535-19369557 CAGGCTCAAGATACTGTTTTGGG - Intronic
951226304 3:20125191-20125213 CAGGCTCCAGAGGCTGAGGCAGG + Intronic
954045567 3:47926811-47926833 CAGGCACAAGTCACTGAATCTGG + Intronic
955052775 3:55428887-55428909 CAGGCTCAAGACACAGTTGATGG - Intergenic
957111066 3:75958566-75958588 CAAGCAAAAGAAACTGATGCAGG + Intronic
957497916 3:81014493-81014515 AATGCTCTAGACACTGATGGGGG + Intergenic
957497935 3:81014746-81014768 AATGCTCTAGACACTGATGGGGG + Intergenic
957497941 3:81014810-81014832 AATGCTCTAGACACTGATGGGGG + Intergenic
959020868 3:101186267-101186289 CTGGCACATGAGACTGATGCTGG + Intergenic
959389576 3:105758344-105758366 CACGATAAAGACACAGATGCTGG + Intronic
964114982 3:153127002-153127024 CAGCCTCCAGAGGCTGATGCAGG - Intergenic
965788777 3:172365034-172365056 CAGTTTCAAGACACTGAGGAAGG - Intronic
967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG + Intronic
968331241 3:197872451-197872473 CAGGCACAAGCCACTGAGCCTGG - Intronic
969936702 4:10689275-10689297 CAGGCACAAGACACTGTACCAGG + Intergenic
970651849 4:18187424-18187446 GAGGATGAAGACATTGATGCAGG + Intergenic
970992009 4:22223504-22223526 CAGCCTAAAGACAGTGAGGCAGG - Intergenic
972341894 4:38159287-38159309 CAGCCCTAAGAAACTGATGCAGG - Intergenic
972560520 4:40224047-40224069 CAGGCTCGAGCCACTGCTCCTGG + Intronic
973209838 4:47603442-47603464 CAGGCTCTAGCCACTGCTCCGGG + Exonic
973619640 4:52713505-52713527 CAGGCACAAGCCATTGAAGCTGG + Intergenic
975359087 4:73445794-73445816 CACACTCAAGAAACTGTTGCTGG - Intronic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978425508 4:108578072-108578094 CAGGCTTAAGCCACCGCTGCTGG - Intergenic
978777461 4:112517228-112517250 GAGGCTCCGGGCACTGATGCAGG + Intergenic
979518158 4:121635318-121635340 CAGGCTTAAGCCACTGCTCCTGG + Intergenic
979524630 4:121704308-121704330 CAGGCACAAGCCACTGATCCTGG - Intergenic
980667041 4:135953815-135953837 CAGGCATAAGACACTGCTCCTGG + Intergenic
982524286 4:156457653-156457675 CAGCCTCAGGACACTAATGCAGG + Intergenic
982552463 4:156819966-156819988 CAGGTTCAAGACTTTGATGGAGG + Intronic
984250174 4:177322481-177322503 CAGGCTCAAGACATTCTGGCTGG - Exonic
985799247 5:1992984-1993006 CAGGCTCAGGACAAGGATACAGG - Intergenic
990035849 5:51318730-51318752 CAGGCACCAAACACAGATGCAGG - Intergenic
990370611 5:55114530-55114552 CAGCCACAGGACACTGATACAGG - Intronic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
993765819 5:91857065-91857087 CAATTTAAAGACACTGATGCAGG + Intergenic
994479941 5:100321941-100321963 CAATTTCAAGACACTGCTGCTGG - Intergenic
997038576 5:130224039-130224061 CCAGCTCAAGACACTCAGGCCGG - Intergenic
997558636 5:134823819-134823841 CAGGCTGAAGACAATGATAGAGG + Intronic
998153354 5:139769747-139769769 CGGACTCAAGACACTGATGGTGG + Intergenic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG + Intergenic
1000921794 5:167146645-167146667 CAGGCTCAAGGCAGTCAAGCTGG - Intergenic
1002086865 5:176781330-176781352 CAGGCTCCAGAAAGAGATGCAGG + Intergenic
1003129380 6:3382211-3382233 CAGGCTCAAGCCTCAGATGCTGG + Intronic
1004205354 6:13587170-13587192 CAGGCCTAAGATACTGAAGCCGG - Intronic
1004303281 6:14477468-14477490 CAGGCTCTACACAATTATGCTGG + Intergenic
1006884423 6:37369014-37369036 GAGGCTCAAAATACAGATGCAGG + Exonic
1007468851 6:42075000-42075022 CAGCCTCAAGACACTGCTGGAGG - Intronic
1008104691 6:47428921-47428943 CAGCCTCATGACACTGTTCCTGG - Intergenic
1010247526 6:73675501-73675523 CAGGTGCAAGCCACTGCTGCTGG + Intergenic
1011636811 6:89382302-89382324 CAGGCACAAGCCACTGCTCCTGG - Intronic
1013403568 6:109821895-109821917 CAGGCTCGAGCCACTGAACCCGG - Intronic
1013842811 6:114418474-114418496 CAAGCTCAAGACAGTACTGCAGG - Intergenic
1015280159 6:131424672-131424694 AAGGCTAAAGACACAGCTGCAGG + Intergenic
1019664478 7:2244586-2244608 CAGGCTCTATACCCTGGTGCTGG + Exonic
1022858114 7:34336968-34336990 CAGGCTCAAGCCACTGTGACTGG + Intergenic
1023121633 7:36915206-36915228 CAGGCTCAAGTCACTGTGCCTGG + Intronic
1026523493 7:71135554-71135576 GAAGATCAAGACACTGGTGCAGG - Intronic
1026594595 7:71723855-71723877 CAGCCTCCAGAGACTGAGGCAGG + Intergenic
1026865102 7:73818831-73818853 CAGGCTCAAGCCACTGTTCCCGG + Intronic
1028591466 7:92500542-92500564 CAGGATCATGACCCCGATGCTGG - Intronic
1029416564 7:100446763-100446785 CATGCTCAAGAAGCTGAGGCTGG + Intergenic
1032063309 7:128743779-128743801 CAGGCTTGAGCCACTGCTGCTGG + Intronic
1034184502 7:149164128-149164150 CAGGCTCAAGCCACTGCGCCCGG - Intronic
1034267673 7:149789123-149789145 CAGGCTCAGGACGCTGCTGTAGG - Intergenic
1034495992 7:151422739-151422761 CAGGTACAACACACTGAGGCAGG - Intergenic
1035539491 8:421703-421725 CTGGCTCTAGTCACTGATGCAGG - Intronic
1038617265 8:29106352-29106374 CAGGCATAAGCCACTGCTGCTGG - Intronic
1038821463 8:30955795-30955817 CAGGCTCAAGCCACTGTGCCTGG + Intergenic
1039148706 8:34479314-34479336 CAGCCTCAAGACACTGCCTCCGG - Intergenic
1039841975 8:41300425-41300447 CAAGCTCAAAACACTGAAGAAGG + Intronic
1041158262 8:55010363-55010385 GAGGCTTAAAACACTGGTGCAGG + Intergenic
1041516980 8:58711381-58711403 CAGGCTCGAGCCACTGAGCCCGG - Intergenic
1041681889 8:60602153-60602175 CAGGCTCAAGCCACTGTGCCTGG + Intronic
1044384882 8:91576031-91576053 CAGCCTTGAGACATTGATGCTGG + Intergenic
1045702665 8:104884812-104884834 GAAGCTCAAGAGACTGATGGAGG + Intronic
1047574354 8:126136452-126136474 CAGCTTCACGACACTGTTGCTGG - Intergenic
1047962267 8:130019102-130019124 CAGGCTCAAGCCACTGCGCCTGG + Intergenic
1048876826 8:138843192-138843214 CAGGCACAAGATGCAGATGCTGG + Intronic
1050040396 9:1487336-1487358 CAGGCACGAGACACTGGTTCAGG - Intergenic
1050330258 9:4538705-4538727 CCGGCTCAAAGCACAGATGCTGG - Intronic
1051050720 9:12928897-12928919 CAGTCCCAAGACTATGATGCTGG - Intergenic
1051829955 9:21265198-21265220 TATGCTGAAGACACTGATGTTGG + Intergenic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1053059535 9:35019793-35019815 CAGGCACGAGACACTGCTCCTGG + Intergenic
1053365471 9:37519533-37519555 ATGGCTCCAGACACTGCTGCAGG - Intronic
1053665303 9:40313440-40313462 CAGCCTCAGGACACTGCTGCCGG + Intronic
1054519312 9:66062844-66062866 CAGCCTCAGGACACTGCTGCCGG - Intergenic
1054857915 9:69921135-69921157 CTGGCTCTGGACACAGATGCAGG + Intergenic
1057492515 9:95532287-95532309 CAGCCTCTAGACACTGAAGGAGG + Intergenic
1057605020 9:96492856-96492878 CAGGCTGGACACACTGCTGCCGG + Intronic
1059320178 9:113463204-113463226 GAGGCTCAAGAGAGTGATCCAGG + Intronic
1059564784 9:115373116-115373138 CAGCCTCAGGAAACTGCTGCAGG - Intronic
1060301153 9:122375305-122375327 CAAGCTCCAGACGCTGAAGCTGG - Intronic
1061034093 9:128103818-128103840 CAGGCTCAAGGTGCTCATGCAGG + Exonic
1062216535 9:135392518-135392540 CAGGCTCACCCCACTGGTGCTGG - Intergenic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1187832201 X:23393626-23393648 CAGGAACAAAGCACTGATGCAGG - Exonic
1189198068 X:39168285-39168307 CAGGTCCAGGACACTGAGGCAGG - Intergenic
1190234599 X:48605943-48605965 CAGCCTAAAGGCACTGAGGCTGG + Exonic
1192579975 X:72272902-72272924 CAGTTGCAAGACACAGATGCTGG + Intronic
1192829615 X:74737520-74737542 CAGACACAAGAGACTGACGCTGG + Exonic
1194979149 X:100422849-100422871 CAACCTCTAGACACTGCTGCAGG - Intergenic
1198822523 X:140664187-140664209 CAGGCGCAAGCCACTGCTCCTGG - Intergenic