ID: 1128376600

View in Genome Browser
Species Human (GRCh38)
Location 15:67080913-67080935
Sequence ATTTATTGGAAGTCTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128376589_1128376600 20 Left 1128376589 15:67080870-67080892 CCGCGATCATCCAAACCTCATCC 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG 0: 1
1: 1
2: 2
3: 24
4: 196
1128376590_1128376600 10 Left 1128376590 15:67080880-67080902 CCAAACCTCATCCTCCTTCTCTT 0: 1
1: 0
2: 6
3: 110
4: 1068
Right 1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG 0: 1
1: 1
2: 2
3: 24
4: 196
1128376592_1128376600 -1 Left 1128376592 15:67080891-67080913 CCTCCTTCTCTTGCCCCAGATAA 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG 0: 1
1: 1
2: 2
3: 24
4: 196
1128376591_1128376600 5 Left 1128376591 15:67080885-67080907 CCTCATCCTCCTTCTCTTGCCCC 0: 1
1: 1
2: 18
3: 297
4: 2895
Right 1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG 0: 1
1: 1
2: 2
3: 24
4: 196
1128376593_1128376600 -4 Left 1128376593 15:67080894-67080916 CCTTCTCTTGCCCCAGATAATTT 0: 1
1: 0
2: 1
3: 30
4: 323
Right 1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG 0: 1
1: 1
2: 2
3: 24
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128376600 Original CRISPR ATTTATTGGAAGTCTGGAGA GGG Intronic
906065555 1:42978066-42978088 ATATATTGGAGGTCTGGGGTGGG - Intergenic
906789626 1:48647254-48647276 ATTTCTTGGGAGTGTGGAGGTGG - Intronic
907262713 1:53233181-53233203 ATCTATTAGAAGTCTGGATTAGG + Intronic
908026296 1:59955128-59955150 ATTTATTTTAATTTTGGAGATGG - Intergenic
909288653 1:73854333-73854355 ATTGATTGGAAGTCTAAATAAGG + Intergenic
910303830 1:85739201-85739223 ATTTCTTGGAAGACAAGAGAAGG - Intronic
912406260 1:109440598-109440620 AATTAGTAGAAGTCTGGGGATGG - Intergenic
912553708 1:110500834-110500856 ATGTAGTGGTAGTCTGGATATGG + Intergenic
915749234 1:158189329-158189351 ATTTATTTGAAGTCTGGAGATGG + Intergenic
917461374 1:175233337-175233359 ATTGAATGGAAGTCTGTTGAGGG + Intergenic
917497238 1:175551835-175551857 ATATATTGGAAGAATGGGGAGGG + Intronic
919421072 1:197371267-197371289 ATTGGTTGTAAGTGTGGAGAAGG - Intronic
920808439 1:209257327-209257349 ATTTGTTTGAAGATTGGAGAAGG + Intergenic
920863880 1:209735226-209735248 CTGCATTGGAAGTTTGGAGAGGG + Intergenic
921421482 1:214953997-214954019 ATATATTGGAGCCCTGGAGAAGG - Intergenic
924497471 1:244603986-244604008 ATTTATTGGTATTTTAGAGATGG - Intronic
1064004489 10:11689219-11689241 ATTTTGTGGAACTCTGGAAAAGG + Intergenic
1067353138 10:45495524-45495546 ATATAAGGGAAGTATGGAGAGGG - Intronic
1071166588 10:82815197-82815219 TTTTATGGAAACTCTGGAGAAGG - Intronic
1072053531 10:91730028-91730050 CTTAATAGGAAGTCTGGAAATGG - Intergenic
1074924470 10:118053282-118053304 ATTTCTCACAAGTCTGGAGATGG + Intergenic
1078986196 11:16602151-16602173 ATGTTTTGGAAGTCATGAGAAGG - Intronic
1079324754 11:19482094-19482116 ATTTATTGAAAGTCTGCTGTGGG + Intronic
1080068143 11:28044053-28044075 AATTCTTGGAAGTCTGTATAAGG + Intronic
1080893414 11:36428657-36428679 TTTTATTGGAATTTTGGAGAGGG + Intronic
1081567746 11:44270312-44270334 ATTTATTTGAGGGCTGAAGATGG + Intronic
1087177387 11:95108107-95108129 ATTTATTGCCAGTTTGGAGTTGG + Intronic
1087226466 11:95606385-95606407 CTTTATTGGCAGTGTGAAGACGG - Intergenic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1089716183 11:120361516-120361538 ATTTATTGGACATCTGGAAATGG + Intronic
1089734027 11:120537354-120537376 AGATATTGGAACTCTGCAGAGGG + Intronic
1089970110 11:122686478-122686500 ATTTATAGGAAAGGTGGAGATGG + Intronic
1091128846 11:133127036-133127058 ATATTTTGAAAGTTTGGAGATGG - Intronic
1094073127 12:26441541-26441563 AATTAATGAAAGCCTGGAGAAGG + Intronic
1094092099 12:26661786-26661808 TTTTAGTGGAGGTCTGGAGTGGG - Intronic
1095510957 12:42951437-42951459 GTTTATGGGATGTCAGGAGAAGG + Intergenic
1095847737 12:46763960-46763982 ATATATTGGCAATCTGGACATGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097952724 12:65450351-65450373 ATTTATTTGCTATCTGGAGATGG + Intronic
1098857980 12:75675350-75675372 ATTTATTGGATTGCTAGAGAAGG + Intergenic
1103796493 12:123506562-123506584 AATTATGGGAAGTGTGGACAGGG + Intronic
1106152817 13:27122444-27122466 CTTTATTGGCAGTGTGGAAACGG + Intronic
1107013242 13:35688414-35688436 TTTTATAGGCAGTCTGGAGAAGG + Intergenic
1108749552 13:53433946-53433968 AATTATTTGAAAACTGGAGAGGG + Intergenic
1112668901 13:101612465-101612487 ATTTGCTGGAAGTCTGGGTATGG + Intronic
1112855182 13:103759920-103759942 GTTTATTTGAGGTCTGGAAAAGG + Intergenic
1114506661 14:23220443-23220465 AATTATTGGAACCCAGGAGATGG + Intronic
1115302342 14:31898522-31898544 AGTTTTTGTAAGTCTTGAGAAGG - Intergenic
1115961566 14:38839260-38839282 ATTTATTGGTTTTCTGGAGAGGG + Intergenic
1116424366 14:44771599-44771621 ATTTGTTGTATGTCTGTAGAAGG - Intergenic
1117879279 14:60294376-60294398 ATTTATTGTAAGTATGGAATTGG - Intronic
1119561569 14:75594301-75594323 ATTAAGGGGAATTCTGGAGAGGG - Intronic
1119689184 14:76657422-76657444 CTTTATAGGCAGGCTGGAGAAGG - Intergenic
1120945605 14:89993440-89993462 ATTTTACTGAAGTCTGGAGAAGG - Exonic
1125724719 15:41862426-41862448 AGTTATTTGAAGGGTGGAGAAGG + Intronic
1126063159 15:44803609-44803631 ATTTGTTGGCAGTCTAGTGAAGG - Intergenic
1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG + Intronic
1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG + Intronic
1133901087 16:9975510-9975532 ATTTATTTGCAGTCTGTGGATGG - Intronic
1133969307 16:10555931-10555953 ATTGTTTGGAAATATGGAGAAGG - Intronic
1136641855 16:31572374-31572396 TGTTATTGGAAGTTTGGTGAGGG - Intergenic
1137944493 16:52720643-52720665 CTTTATTGGAAGGCTGTAGTGGG - Intergenic
1141514714 16:84536124-84536146 TTTTATAGGCAGGCTGGAGAAGG - Intronic
1142953637 17:3505121-3505143 AGCTAATGGAAGTGTGGAGATGG - Intronic
1146509438 17:33433397-33433419 ATTGAGTGGAAGTTTGGAGGAGG + Intronic
1153936292 18:9927183-9927205 ATTAAGTGGATGTCTGGACAGGG + Intronic
1154407843 18:14111418-14111440 AATTGCTGGAAGTCAGGAGAAGG + Intronic
1155274594 18:24173968-24173990 ATTTATATGACGTCTGGAAAAGG - Intronic
1155828557 18:30481556-30481578 ATTTATTGGAAATCAATAGATGG + Intergenic
1156598005 18:38570157-38570179 ATTTAGTGGATGTGTGGAGTAGG + Intergenic
1156636573 18:39037805-39037827 GTTTATTGGAAGTGTGCTGAGGG + Intergenic
1157934892 18:51861984-51862006 ATTAATTTGTAGTTTGGAGAAGG + Intergenic
1158015999 18:52785004-52785026 TTTTATAGGAAGGCTGGAGAAGG + Intronic
1159744707 18:72217976-72217998 TTTTATTGGAAAACTGGAAATGG - Intergenic
1159966475 18:74600200-74600222 ATTTATTGGAAGGCTATAGATGG + Intronic
1165759548 19:38312847-38312869 AATTATTCGAAGCCTGAAGACGG + Intronic
1168300213 19:55400723-55400745 TTGTGTTGGAAGTCTGGACACGG - Exonic
925426964 2:3757809-3757831 ATCTGTTGGAACTGTGGAGATGG - Intronic
926115396 2:10210015-10210037 AGTTACAGGAAGTCTGGAGAAGG - Intronic
926710067 2:15872145-15872167 ATTTACTGGATGTCTGTTGAAGG - Intergenic
929379270 2:41331137-41331159 ATTTATTGGAATTTTGTGGATGG + Intergenic
931127815 2:59297197-59297219 ATCTAATGGAAGTCTGCAGTGGG - Intergenic
932498815 2:72162115-72162137 ATTTTTTGGAAGCTTGGTGAAGG - Intergenic
933207000 2:79518262-79518284 ATTTATGGGATGTATTGAGATGG + Intronic
935459340 2:103310140-103310162 GTTATTTGGAAGTCTGCAGAGGG - Intergenic
935880487 2:107559924-107559946 TTTTATAGGCAGGCTGGAGAAGG - Intergenic
936627808 2:114167013-114167035 AATTATGGGAATTCAGGAGAAGG + Intergenic
936977941 2:118237877-118237899 AGTTATTGCAAATATGGAGAAGG + Intergenic
937769807 2:125707086-125707108 GATGATTTGAAGTCTGGAGAAGG - Intergenic
941975103 2:171395358-171395380 ATTTATTGTAAGTATTGATATGG - Intronic
942488238 2:176462028-176462050 ATCTTTTGGAAGTCTGGATTAGG - Intergenic
942533243 2:176935199-176935221 ATTTATTGGTCAGCTGGAGAAGG - Intergenic
943654872 2:190497812-190497834 ATTTATTGAAAGTCTGGTGGGGG + Intronic
944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG + Intronic
946971925 2:225103034-225103056 ATTTTTTAAAAGTCTGTAGAAGG + Intergenic
948079645 2:235195394-235195416 ATTTGATGGAAGGCTGGAGAGGG - Intergenic
949005347 2:241643537-241643559 ATTACCTGGAAGTCTAGAGATGG + Intronic
1169069758 20:2717350-2717372 AATTATTGTAAGTCTTTAGAAGG + Intronic
1169940938 20:10936619-10936641 ATGGATTAGAAGTCTGGATATGG + Intergenic
1170876556 20:20255161-20255183 ATTGATTGGAGGGCTGGAGAAGG - Intronic
1172167400 20:32907575-32907597 GTTTTCTGGAACTCTGGAGATGG + Intronic
1172168383 20:32913205-32913227 ATTTATCAGAGTTCTGGAGATGG + Intronic
1175406291 20:58732386-58732408 ATTTATTGAGAGGCTGGACATGG - Intergenic
1177424610 21:20906202-20906224 ATTTCTTGGAAGTTTGGGGGTGG - Intergenic
1177960357 21:27658623-27658645 TTATTTTGTAAGTCTGGAGATGG - Intergenic
1178288133 21:31343290-31343312 TTTTATTTCAAGTCTGGAGCTGG - Intronic
1178583111 21:33852353-33852375 AATAATTGGAGGTGTGGAGATGG + Intronic
1179177276 21:39017834-39017856 ATTTATTTAATCTCTGGAGATGG - Intergenic
1181337207 22:22146409-22146431 ATTTGTCTGAAGTTTGGAGAAGG - Intergenic
1181446744 22:22982418-22982440 TTTTATAGGCAGGCTGGAGAAGG - Intergenic
1181560958 22:23699549-23699571 ATTTACTGAAGGGCTGGAGATGG + Intergenic
1182112981 22:27736315-27736337 ATTTCTCGGAAGTCTGGAGCAGG + Intergenic
952315840 3:32231624-32231646 ATTTATTGAAGGAATGGAGAGGG + Intergenic
952720060 3:36523232-36523254 ATTTATAGGAACTCTTGAAATGG - Intronic
952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG + Intergenic
953120022 3:40030983-40031005 ATTTTTTCAAAGTCTGGGGAGGG + Intronic
955149049 3:56348777-56348799 ATTTATTGGAGCTCTGTAGGTGG - Intronic
955396920 3:58564141-58564163 ATTTACAAGAATTCTGGAGAAGG + Intronic
955621583 3:60869997-60870019 ATTTATTGCAAGTCTTTATAAGG - Intronic
956108008 3:65842060-65842082 ATATAGTGGAGGTCTGGAGCAGG - Intronic
958926765 3:100166736-100166758 ATTTTTTGGGAGGCTGGAGAGGG + Intronic
959179746 3:102963167-102963189 ATTTCCAGGAAGTCTGAAGAGGG - Intergenic
959615405 3:108341913-108341935 ATTGATTTGATGTCTGGAGCTGG - Intronic
959782718 3:110255698-110255720 ATTTAGTGGCAGTGTGAAGAAGG - Intergenic
960277344 3:115742919-115742941 TTTCACTGAAAGTCTGGAGATGG - Intergenic
962453457 3:135541748-135541770 ATTTATTGTAAGGCTGGGGCAGG - Intergenic
962458895 3:135590988-135591010 CTATATTGGAAGGCTGGAGGAGG - Intergenic
962537959 3:136348176-136348198 ATTTATTAGAAGCATGAAGAAGG + Intronic
962554198 3:136529412-136529434 ATTTACTGGTAGTCTGATGAAGG - Intronic
965888709 3:173482445-173482467 GTGTATTGAAAGTGTGGAGATGG - Intronic
966202539 3:177372424-177372446 ATTTACTGGAAGGTAGGAGAGGG + Intergenic
972254009 4:37334232-37334254 ATTTATTGAATGTCTTGAGGTGG - Intronic
972695022 4:41436775-41436797 ATATATTGGAAGTATGGAGCTGG + Intronic
973196815 4:47454103-47454125 ATTTATTGGAAATATTGAGGAGG - Intronic
973613123 4:52656479-52656501 ATGTATAGGAAGGCTGGAGTGGG - Intronic
974821486 4:67071679-67071701 ATTTAGTTGAAGTGTGAAGAGGG - Intergenic
975767928 4:77688532-77688554 ATTGTTGGGAAGCCTGGAGAAGG - Intergenic
975843067 4:78497118-78497140 ATTTTTTGGATCTCTGTAGAGGG - Intronic
976398903 4:84585886-84585908 ATTTATTGGAAGTCTGTACAAGG + Intronic
976992633 4:91386615-91386637 ACTTATTGGCAGTCTGTAGGAGG - Intronic
977304477 4:95305422-95305444 ATCTGCTTGAAGTCTGGAGATGG + Intronic
977352687 4:95908129-95908151 ATTTATTGTAAGTCTGAGGATGG - Intergenic
978344572 4:107753656-107753678 AGTTATTTGAATTCTAGAGAAGG + Intergenic
978662300 4:111141758-111141780 ACTTGTTGGAAGTCTGTAAAAGG + Intergenic
978758955 4:112334476-112334498 ATTTATTGGCAGTATGGACAGGG - Intronic
980453470 4:133007558-133007580 ATTTATTCCAAGTCTGGAAAAGG - Intergenic
980881029 4:138710030-138710052 ATTTATTGTAAGGATGCAGAGGG + Intergenic
980950516 4:139371649-139371671 ATTTATTGGAAGACTGCACAGGG + Intronic
984800706 4:183714058-183714080 TTTTATGGGAAGGCTGAAGAGGG + Intergenic
990047372 5:51449964-51449986 AGTGATTGGAAGTTTGCAGAGGG + Intergenic
990732841 5:58828385-58828407 ACTAAATGCAAGTCTGGAGAGGG - Intronic
991311090 5:65242849-65242871 ATTTGTTTGAGGTGTGGAGAGGG + Intronic
992966313 5:82004419-82004441 AGTTATAGGAAATCAGGAGATGG + Intronic
993102913 5:83563362-83563384 ATTTGTTTGCAGTCTGGAGGGGG - Intronic
993330420 5:86593450-86593472 TTTTCTTGGAATCCTGGAGAGGG + Intergenic
994382962 5:99093604-99093626 ATTGGCTAGAAGTCTGGAGATGG - Intergenic
995431700 5:112086588-112086610 ATTTATATGAAGTCTGTAGGAGG - Intergenic
998363554 5:141612609-141612631 AATTAGTGGTAATCTGGAGATGG + Intronic
998492548 5:142559587-142559609 ATTTGTGGTAAGCCTGGAGACGG + Intergenic
999448515 5:151660625-151660647 ATTGATTTGAAGTGGGGAGAAGG + Intergenic
1000361716 5:160453779-160453801 ATTAACTGGAAGTCTGGAGTTGG + Intergenic
1002012759 5:176297094-176297116 ATTTATTGAAAGTTTGTGGATGG + Intronic
1006540882 6:34738824-34738846 AATTATTGGAAGCCAGGAGGTGG - Intergenic
1009264759 6:61539249-61539271 ATGTATTAGAAATCTGGTGAAGG - Intergenic
1009338448 6:62524038-62524060 ATTTAGTGGAAGGCAGGAGAAGG - Intergenic
1010706088 6:79112554-79112576 ATTTATTGGAAGTCAAGGCAAGG - Intergenic
1011104957 6:83769178-83769200 ATTTATTGGTATTTTGGAGTTGG + Intergenic
1015567014 6:134583976-134583998 TTTGATTGGAATCCTGGAGATGG + Intergenic
1016327703 6:142921832-142921854 ATTTTTTGGAAGTGTGGAGAAGG - Intronic
1016835031 6:148468375-148468397 ATTTCTAGGAAGTCAGCAGATGG + Intronic
1019234627 6:170600003-170600025 ATTTAATGAGATTCTGGAGAAGG - Intergenic
1022590988 7:31662690-31662712 AATTCTTGGAATTCTGGATAAGG - Intergenic
1024245503 7:47466770-47466792 ATTTATTAGGAGTTTGGAAAGGG + Intronic
1025235394 7:57231392-57231414 ATGTATTGGACTTCTTGAGATGG - Intergenic
1026331147 7:69353653-69353675 GTTTATTTGAAGACTTGAGAAGG - Intergenic
1027566475 7:79801051-79801073 ATTGATGGGAATTCTGGAGAGGG - Intergenic
1028154272 7:87411469-87411491 ACTTGTTGGAAGTCTGGCAAAGG - Intronic
1028514077 7:91657027-91657049 ATTGATTGGAAGTCAGGAGGAGG + Intergenic
1030374959 7:108744559-108744581 GCTTATTGGAGGTGTGGAGAAGG + Intergenic
1031383851 7:121121622-121121644 ATTGATTGGAAGTGTTGATAAGG + Intronic
1032744772 7:134774595-134774617 ATTTGTTGTAAGTCTGGGTAAGG - Intronic
1035432743 7:158834473-158834495 ATTTCTTACAATTCTGGAGACGG - Intergenic
1036725305 8:11215367-11215389 TTTTATAGGAAGTCTTCAGAGGG - Intergenic
1037090814 8:14915712-14915734 TTTTATAGGCAGGCTGGAGAAGG - Intronic
1037097271 8:15000768-15000790 TTTTATAGGCAGGCTGGAGAAGG - Intronic
1037157912 8:15728436-15728458 AATGATTGGATGTGTGGAGAGGG + Intronic
1039932207 8:42003415-42003437 AATTATTGGAAGCTTGGAGGAGG - Intronic
1041122065 8:54596475-54596497 TTATATTGGAAATTTGGAGAGGG - Intergenic
1042250745 8:66753856-66753878 ATATTTTGGAGGTATGGAGAGGG - Intronic
1042956895 8:74260555-74260577 ACTTAATGGAAGTCTGAAAAAGG + Intronic
1045409796 8:101905382-101905404 AGTGATTGGGAGGCTGGAGAAGG - Intronic
1045934593 8:107664257-107664279 ATTTATTGGTGGTCTGTACAGGG - Intergenic
1046126251 8:109912457-109912479 ATATATTGGAAATATGCAGATGG + Intergenic
1046227394 8:111301503-111301525 ATTTATATGAAGGCTGGACATGG - Intergenic
1047158056 8:122344080-122344102 ATTTGTTGAACGTCTGCAGATGG + Intergenic
1048673243 8:136747385-136747407 ATTTATTGGCAGGCTTGAGGAGG + Intergenic
1050776658 9:9271355-9271377 GTTAATTAGAAGTTTGGAGAAGG - Intronic
1051506918 9:17837610-17837632 TTTTACTGGGAGTCTGGAGAGGG + Intergenic
1059704188 9:116804875-116804897 ATTTGTTGTATGTATGGAGAAGG - Intronic
1060386220 9:123231608-123231630 ATTTATTTGATGTCAGGAGAAGG - Intronic
1062013732 9:134280823-134280845 AGATATTGGGAGTCAGGAGAGGG + Intergenic
1185743130 X:2549965-2549987 TTTTATAGGCAGGCTGGAGAAGG + Intergenic
1185837534 X:3359395-3359417 ATTTATAGGAATTCTCGAGATGG + Intergenic
1187260746 X:17683039-17683061 ATGTATTGGAAGGATGGATATGG - Intronic
1187567341 X:20464565-20464587 ATTTGATGCAACTCTGGAGAAGG + Intergenic
1188158503 X:26772008-26772030 GTCTATTGGAAGTCAGGAGTTGG - Intergenic
1188563726 X:31500277-31500299 AATTATAGAAAGTCTGGAGGTGG - Intronic
1188957918 X:36455564-36455586 ATTTATTGGCATTCCTGAGAAGG + Intergenic
1189217820 X:39342460-39342482 AGGTATTGGAAGTCTGAAAAAGG + Intergenic
1191936209 X:66429691-66429713 TTATATTGGGAGGCTGGAGAAGG + Intergenic
1192780330 X:74287543-74287565 CTTTATTGGAAGTCTGTGCATGG - Intergenic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193197573 X:78652291-78652313 ATTTATGGTCAGTCTGTAGAAGG - Intergenic
1193482766 X:82047446-82047468 AGTTATTGGAGTTCTTGAGATGG - Intergenic
1195049030 X:101080105-101080127 CATTATTGGAAGTCTGGCAAAGG - Intronic
1195346297 X:103953899-103953921 GTTTGTTGGAGGTGTGGAGAAGG - Intronic
1195545449 X:106107789-106107811 ATTTCTTACAATTCTGGAGATGG + Intergenic
1196306366 X:114107982-114108004 ATTTATTCTAGGTCTGGTGAAGG - Intergenic
1198619606 X:138491580-138491602 ATTTATTGGATTTCTGTGGAAGG - Intergenic
1202194887 Y:22290070-22290092 CTTTATTGGAAGTCCGGTGGGGG + Intergenic
1202200110 Y:22337351-22337373 CTTTATTGGAAGTCAGGTGGGGG - Intronic
1202257081 Y:22932546-22932568 ATTGAGTGAAATTCTGGAGAAGG + Intergenic
1202410072 Y:24566294-24566316 ATTGAGTGAAATTCTGGAGAAGG + Intergenic
1202460710 Y:25103778-25103800 ATTGAGTGAAATTCTGGAGAAGG - Intergenic