ID: 1128376648

View in Genome Browser
Species Human (GRCh38)
Location 15:67081281-67081303
Sequence CTAGTCATCCCCATGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128376648_1128376655 5 Left 1128376648 15:67081281-67081303 CCTGGTGTCATGGGGATGACTAG 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1128376655 15:67081309-67081331 CTTGTGGGTAAGGCTGGAAGCGG 0: 1
1: 0
2: 2
3: 59
4: 500
1128376648_1128376652 -5 Left 1128376648 15:67081281-67081303 CCTGGTGTCATGGGGATGACTAG 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1128376652 15:67081299-67081321 ACTAGGCCATCTTGTGGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 99
1128376648_1128376651 -10 Left 1128376648 15:67081281-67081303 CCTGGTGTCATGGGGATGACTAG 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1128376651 15:67081294-67081316 GGATGACTAGGCCATCTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1128376648_1128376653 -1 Left 1128376648 15:67081281-67081303 CCTGGTGTCATGGGGATGACTAG 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1128376653 15:67081303-67081325 GGCCATCTTGTGGGTAAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128376648 Original CRISPR CTAGTCATCCCCATGACACC AGG (reversed) Intronic
903784816 1:25853066-25853088 ATAGTCTTCTCCATGACACATGG - Intronic
903860637 1:26362422-26362444 CTAGTCTTCCCCAGGACCCTAGG + Intronic
904973622 1:34438585-34438607 CCACTCATCCACATCACACCGGG + Intergenic
906410085 1:45571398-45571420 CAAGTCCCCGCCATGACACCTGG + Intergenic
910917846 1:92310042-92310064 CTAGTGATCCGTATGAGACCAGG + Intronic
911140002 1:94489917-94489939 CAAGTCATTCCCTTGATACCTGG + Exonic
912203032 1:107480082-107480104 CTCCTCATCCCCATGCCTCCCGG + Intronic
912715327 1:111979555-111979577 CTACTCATTCCCATGCCATCAGG - Intronic
915506336 1:156358814-156358836 CTAGTGGTCTCCATGACAACAGG + Intronic
918976058 1:191488096-191488118 CAGGTCCTTCCCATGACACCTGG - Intergenic
924297987 1:242608087-242608109 CTGGTCTTACCCATGACACCTGG + Intergenic
1065401666 10:25309653-25309675 CAGGTCATGCCCATGACACATGG - Intronic
1067170039 10:43898739-43898761 CTGGCCACCCCCATGACCCCTGG - Intergenic
1068739458 10:60452104-60452126 CTAGACATCCCCATGACCCTAGG + Intronic
1069874303 10:71552289-71552311 CTAGTGATCCACATGAGAGCTGG + Intronic
1070513531 10:77182694-77182716 CTAGTAGACCCCATGACAGCAGG + Intronic
1077489662 11:2855024-2855046 CCACTCTTCCCCATGGCACCTGG - Intergenic
1080449613 11:32368159-32368181 TTAGTCCTTCCCATGACACATGG + Intergenic
1080791798 11:35527954-35527976 CTGGTCCTTCCCATGACACGTGG + Intronic
1085403818 11:76249984-76250006 CTAGGCATCCCCATGCTATCTGG + Intergenic
1085639159 11:78180826-78180848 CTAGTCCTGCCCTTGACACATGG - Intronic
1086231325 11:84573728-84573750 CTTTTCCTCCCCATGACATCTGG - Intronic
1086265939 11:84998235-84998257 CTGGTCCTGCCCTTGACACCTGG - Intronic
1089135622 11:116246808-116246830 CTAGTCCCTCCCATGACACATGG + Intergenic
1090250084 11:125244940-125244962 CCAGTCTCCCCCATGAGACCAGG - Intronic
1090637354 11:128698269-128698291 CTTGTAATCTCCATGTCACCTGG + Intronic
1093743271 12:22712298-22712320 CTCGTCATCCACGTGACTCCAGG + Intergenic
1096761180 12:53843329-53843351 CACATCATCCCCATCACACCAGG - Intergenic
1098710148 12:73747722-73747744 CTAGTCTTGCCCTTGACACATGG - Intergenic
1098833144 12:75388064-75388086 CTAGTCTCTCCCATGACACGTGG - Intronic
1099388908 12:82054050-82054072 CTAGTGATCCACATGACAAGAGG - Intergenic
1099801270 12:87460046-87460068 CTGGTCTCCCCCTTGACACCTGG + Intergenic
1100785476 12:98073634-98073656 CTGGGCATCCCCAGGTCACCAGG + Intergenic
1103263666 12:119610835-119610857 CTACTCATCCCCACAACCCCTGG + Intronic
1104190314 12:126475880-126475902 CTAGTCCCTCCCATGACACGTGG + Intergenic
1107934858 13:45337311-45337333 CTTGTCATCCACACAACACCAGG - Exonic
1109755157 13:66748877-66748899 CTAGTCCTGCCCTTGACACAAGG - Intronic
1110882504 13:80589427-80589449 CTGGTCCTTCCCATGACACATGG + Intergenic
1112326655 13:98446306-98446328 CCTGTCATCCCCGTGACACCTGG - Intronic
1113359739 13:109619290-109619312 CTGGTCCTCCCCATGACATGTGG + Intergenic
1116418026 14:44701646-44701668 CTAGGCAGCCCCCAGACACCTGG - Intergenic
1117638693 14:57774560-57774582 GTAGTCTTGCCCATGAGACCGGG + Intronic
1120228050 14:81812619-81812641 TTATTCAAGCCCATGACACCTGG + Intergenic
1120720519 14:87885447-87885469 CTAGTCCCTCCCATGACACGTGG + Intronic
1125520310 15:40344684-40344706 CTTGCCATCCCCATGAGACTGGG + Intergenic
1128376648 15:67081281-67081303 CTAGTCATCCCCATGACACCAGG - Intronic
1128482367 15:68050355-68050377 CTAGTCCTGCCCTTGACACTTGG + Intergenic
1129166909 15:73783718-73783740 CTGGTCCTTCCCATGACACATGG - Intergenic
1130754243 15:86745813-86745835 CTCATCTTTCCCATGACACCTGG + Intronic
1130841476 15:87704925-87704947 CTGGTCACCACCATCACACCTGG - Intergenic
1131575033 15:93580288-93580310 CTATTCATCTTCATGACAGCTGG - Intergenic
1132293956 15:100721486-100721508 CTAGTTATCCCCTTTACACATGG + Intergenic
1132749769 16:1452158-1452180 CTGGTCAACCCCATGGCCCCGGG + Intronic
1134326642 16:13213705-13213727 CTAGTCATTCCCAAGACCCTTGG - Intronic
1135862305 16:26067739-26067761 CAGCTCCTCCCCATGACACCTGG - Intronic
1136073151 16:27800957-27800979 CCAGTCATCCCCATATCACCGGG - Intronic
1139776998 16:69322632-69322654 CAAGTCATCTCCATGGCTCCTGG - Exonic
1144992222 17:19241132-19241154 CTCTTCATCCCCATGAGACTTGG - Intronic
1152038933 17:77890811-77890833 CTGGTCATCCCCCTGACACCTGG + Intergenic
1152782700 17:82233186-82233208 CAAGTCAGCCCCTGGACACCAGG + Intronic
1153361952 18:4207392-4207414 CTGGTCTCTCCCATGACACCTGG + Intronic
1156701077 18:39825750-39825772 CAAGTCTTCACCATGACTCCAGG + Intergenic
1158276368 18:55772576-55772598 CTAGTCCTGCCCTTGACACATGG - Intergenic
1159204674 18:65233832-65233854 CTAGTCTCACCCTTGACACCTGG - Intergenic
1159261198 18:66015627-66015649 CTAGTCCTGCCCTTGACACATGG + Intergenic
1159937180 18:74378546-74378568 CTAGTCATGCTCATGACCACTGG + Intergenic
1161094118 19:2378986-2379008 CTAGTCCCTCCCATGACACATGG + Intergenic
1162721276 19:12664476-12664498 CTAGGCATCCACTTGCCACCCGG + Intronic
1168583989 19:57578189-57578211 TTAGTCATCACCAAGTCACCTGG - Intronic
926978060 2:18534633-18534655 GTAGGCATCCCCTTGGCACCTGG - Intergenic
928122456 2:28592737-28592759 CTAGTTATCCCCAAACCACCTGG - Intronic
928807686 2:35180602-35180624 CTGGTCTTTCCCTTGACACCCGG + Intergenic
930280839 2:49367770-49367792 CTAGTCATCTCCAGTACACATGG + Intergenic
931162370 2:59705773-59705795 CTAGTCTCTCCCTTGACACCTGG + Intergenic
932313054 2:70759585-70759607 CTTTTCATTCCCATGACAGCTGG + Intronic
937176061 2:119936399-119936421 CTGGTCCTGCCCTTGACACCTGG - Intronic
939666962 2:144964401-144964423 CTAGTCCTGCCCTTGACACATGG - Intergenic
941077553 2:161023007-161023029 CTGGTCCTTCCCATGACACATGG + Intergenic
945300793 2:208214649-208214671 CTTGTCATCCACCTAACACCAGG - Intergenic
946596459 2:221310792-221310814 CTGGTCCTTCCCATGACACGTGG + Intergenic
948446023 2:238033495-238033517 CTAGTGACCCACATGACACCTGG - Intronic
1178770997 21:35504020-35504042 CTGTTCATCCCCATAACACATGG + Intronic
1179438464 21:41377719-41377741 CCACACATCTCCATGACACCAGG + Intronic
1181951069 22:26554298-26554320 CCAGTCTTGCCCCTGACACCTGG + Intronic
1184395312 22:44232472-44232494 CTGGTCCTACCCTTGACACCTGG - Intergenic
951288839 3:20850238-20850260 CTATTCGTTCCCATGACAGCTGG - Intergenic
951577988 3:24133072-24133094 CTATTCATCCCCCTGATTCCAGG - Intronic
953678712 3:45023700-45023722 CTGGTCTTTCCCATGACACATGG + Intronic
956399785 3:68865370-68865392 CAGGTCCTCCCCATGACACATGG - Intronic
956680348 3:71773553-71773575 ATGGTCATGCCCATGATACCAGG - Intronic
961447634 3:126988304-126988326 CCAGGTATCCCCAGGACACCTGG - Intergenic
963150534 3:142041359-142041381 CTGGTCCTTCCCATGACACATGG - Intronic
964965980 3:162494590-162494612 CTAGTCCTGCCCTTGACACGTGG - Intergenic
967525046 3:190482672-190482694 CAAGTCCCTCCCATGACACCTGG - Intergenic
970505958 4:16730799-16730821 CTATTCATTGTCATGACACCTGG + Intronic
971440234 4:26677665-26677687 CTAGTCCCTCCCATGACACATGG - Intronic
971552307 4:27973259-27973281 CTGGTCGTGCCCTTGACACCTGG + Intergenic
974013648 4:56629616-56629638 CCAGTCATTCCCCTGACACATGG + Intergenic
976680653 4:87752746-87752768 CTAGTCCCTCCCATGACACATGG + Intergenic
981438178 4:144750576-144750598 TCAGTCATCCCCATGACACTGGG + Intergenic
983011675 4:162555063-162555085 CGAGTCCTTCCCATGACACATGG - Intergenic
986426708 5:7638858-7638880 CTAGACACTCCCATGACACATGG - Intronic
988153349 5:27416124-27416146 CGAGTCCTTCCCATGACACGTGG - Intergenic
989955783 5:50358133-50358155 CTGGTCCCTCCCATGACACCTGG - Intergenic
990805525 5:59656485-59656507 CTGGTCAGCCACATGACACGTGG - Intronic
992422957 5:76625462-76625484 CTAGTCTTCCCCTTTCCACCCGG + Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
994158503 5:96529658-96529680 CTAGTCCCTCCCATGACACGTGG - Intronic
997409546 5:133680659-133680681 CTTGTCAGCCCCATGAGACAAGG + Intergenic
998433177 5:142084163-142084185 CTGGTCTTTCCCTTGACACCTGG - Intergenic
999697539 5:154199902-154199924 CTAATCATCACCATGACACTAGG - Intronic
1000010147 5:157223505-157223527 CTAGCCATCCACATGACTCAGGG + Intronic
1000788190 5:165571701-165571723 CAAGTCCTTCCCATGACACATGG + Intergenic
1001763537 5:174226710-174226732 CTAGTTATGCCCATGAGACTTGG + Intronic
1003541938 6:7025657-7025679 CTAGTCACCCCCCTTTCACCAGG + Intergenic
1004118657 6:12797123-12797145 CTAGGCATCTCCATTACTCCTGG - Intronic
1005331945 6:24759320-24759342 ATAGGCACGCCCATGACACCGGG - Intergenic
1007493791 6:42245023-42245045 CTTCTCATCCCCCTGACACCTGG + Intronic
1009550931 6:65090171-65090193 CTGGTCCTGCCCTTGACACCTGG - Intronic
1009805085 6:68591878-68591900 CAAGTCCTTCCCATGACACATGG + Intergenic
1011948178 6:92933814-92933836 CTTGTCCTTCCCATGACACATGG + Intergenic
1012541411 6:100366287-100366309 CTGGTCTTCCCCTTGACACATGG - Intergenic
1014987533 6:128030021-128030043 CTAGTGCTCCCCGTGACATCAGG - Intronic
1016452766 6:144200373-144200395 CTTGTCATCCACACAACACCAGG - Intergenic
1017483250 6:154879299-154879321 CTACTGCTCCCCATGGCACCAGG - Intronic
1017654585 6:156615190-156615212 CTAGTCCCTCCCTTGACACCTGG + Intergenic
1017709834 6:157157442-157157464 CTGGTCATCAGCCTGACACCTGG - Intronic
1019954405 7:4401951-4401973 CTGGTCCTTCCCATGACACGTGG + Intergenic
1020269955 7:6589110-6589132 CTCTTGATCCCCTTGACACCAGG - Exonic
1020528455 7:9295829-9295851 CTGTTCATCCCCATCAAACCAGG - Intergenic
1022581666 7:31561309-31561331 CCAATCATTCCCATCACACCTGG - Intronic
1024868102 7:53926941-53926963 CCGTTCATGCCCATGACACCAGG - Intergenic
1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG + Intergenic
1031882268 7:127210719-127210741 GTACTCAGCCCCAAGACACCAGG + Intronic
1033118514 7:138647001-138647023 CAAGTCTTCCTCATGACAGCTGG - Intronic
1034010560 7:147524832-147524854 CTAGTGGTCACAATGACACCAGG + Intronic
1034163728 7:149010546-149010568 CTACAAATCCCCAGGACACCTGG - Intronic
1035522641 8:287401-287423 CTTGGCAGCCCCATGCCACCAGG - Intergenic
1036694089 8:10963447-10963469 CTGGTCATCCCAGTGACAGCAGG - Intronic
1037330944 8:17742965-17742987 CTTTTCATCCCCGTGACACAGGG + Intronic
1038652061 8:29413495-29413517 CTAGTCAGCCACATGACCACAGG + Intergenic
1040650639 8:49445536-49445558 CTAGTCCCTCCCATGACACGTGG - Intergenic
1041650540 8:60297953-60297975 ATAGTCATCCCCAAGGCACAAGG - Intergenic
1041823687 8:62067749-62067771 CTGGTCCTTCCCATGACACTTGG - Intergenic
1042407690 8:68423979-68424001 CTAGTCCTGCCCTTGACACATGG + Intronic
1044566197 8:93663218-93663240 CTAGTTATACCCAGGCCACCAGG + Intergenic
1046537491 8:115533906-115533928 CTACTAATCCCCATCAGACCAGG + Intronic
1057851730 9:98571425-98571447 CTGTTCATCCCCCAGACACCTGG - Intronic
1058242691 9:102586140-102586162 ATAATCATCCCCATGACAAGGGG + Intergenic
1061672444 9:132196590-132196612 CTAGTCATCCCTCTGACCCTGGG + Intronic
1062490940 9:136804655-136804677 CTGCCCATCCCCATGACAGCTGG + Intronic
1186069942 X:5808649-5808671 CGAGTCCTTCCCATGACACATGG + Intergenic
1191602954 X:63030599-63030621 CTAGTCCTGCCCTTGACACATGG + Intergenic
1191740650 X:64432997-64433019 CTTGTCACCCCCTTGGCACCTGG - Intergenic
1191936841 X:66436125-66436147 CTATTCAACCCCATCACACAAGG - Intergenic
1192565540 X:72160402-72160424 TTTGTCATCCACATAACACCAGG + Intergenic
1194447322 X:94004651-94004673 CTGGTCTCTCCCATGACACCTGG - Intergenic
1195608217 X:106834382-106834404 CTAGTCCTGCCCTTGACACGTGG + Intronic
1197035073 X:121863611-121863633 TTTGTCATCCACATAACACCAGG - Intergenic
1197885709 X:131215958-131215980 CTAGTCATCCACAGGACAGATGG + Intergenic
1200151222 X:153952387-153952409 CTCGTCCTCCCCATCACATCTGG + Intronic
1200814421 Y:7516902-7516924 CGACTCCTTCCCATGACACCTGG - Intergenic
1202148246 Y:21822257-21822279 CTGGACATCCCCATCACAACAGG + Intergenic