ID: 1128377963

View in Genome Browser
Species Human (GRCh38)
Location 15:67090709-67090731
Sequence GCAGTAAGGAGAAGCATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128377963_1128377972 16 Left 1128377963 15:67090709-67090731 CCCTAGATGCTTCTCCTTACTGC 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1128377972 15:67090748-67090770 ACTCCCATCTCCCTGTTTTCTGG 0: 1
1: 1
2: 0
3: 34
4: 252
1128377963_1128377973 17 Left 1128377963 15:67090709-67090731 CCCTAGATGCTTCTCCTTACTGC 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1128377973 15:67090749-67090771 CTCCCATCTCCCTGTTTTCTGGG 0: 1
1: 0
2: 2
3: 61
4: 397
1128377963_1128377974 18 Left 1128377963 15:67090709-67090731 CCCTAGATGCTTCTCCTTACTGC 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1128377974 15:67090750-67090772 TCCCATCTCCCTGTTTTCTGGGG 0: 1
1: 0
2: 2
3: 46
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128377963 Original CRISPR GCAGTAAGGAGAAGCATCTA GGG (reversed) Intronic
903991570 1:27274386-27274408 GCAGTCAGGAGAATCATTTGAGG + Intronic
905718605 1:40175873-40175895 GCAGTAGGAAGAAACTTCTAGGG - Intronic
908411824 1:63873903-63873925 TGAGTCAGGAGAAGTATCTAAGG - Intronic
908945961 1:69497424-69497446 GGAGGAAGGAAAAGCATCAAAGG + Intergenic
909225209 1:73011323-73011345 GCAATAAGAAAAAGCATTTATGG - Intergenic
909663871 1:78112512-78112534 GGAGTATGGAGCAGCACCTATGG - Intronic
911632246 1:100196383-100196405 CCAGAAAGGAGAAGTATATAAGG - Exonic
912483114 1:110000325-110000347 GGAGTAAGGAGGAGAATGTATGG - Intronic
913208786 1:116566310-116566332 GGAGTAAGGAGATGCAAATATGG + Intronic
913959584 1:143328024-143328046 GCTCTGAGTAGAAGCATCTAGGG + Intergenic
913972323 1:143424256-143424278 GCTCTGAGCAGAAGCATCTAGGG - Intergenic
914053943 1:144153597-144153619 GCTCTGAGTAGAAGCATCTAGGG + Intergenic
914066705 1:144249869-144249891 GCTCTGAGCAGAAGCATCTAGGG - Intergenic
914112448 1:144716485-144716507 GCTCTGAGCAGAAGCATCTAGGG + Intergenic
914125203 1:144812768-144812790 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
915445240 1:155970811-155970833 GCAGGAAAGAGAAGGATCTTGGG - Intronic
916317577 1:163467434-163467456 ACAGTAAGCAAGAGCATCTAGGG + Intergenic
917392778 1:174557424-174557446 GAAGTAAGGAGAAGAATTTCTGG - Intronic
918770444 1:188550928-188550950 GCACCAGGGAGAAGCAACTATGG - Intergenic
1063365498 10:5487877-5487899 ACAGTAAGGAGAAGCACCCAAGG + Intergenic
1063621141 10:7650417-7650439 TCAGAAAGGAGAAGCATTAAGGG - Intronic
1063925051 10:10969336-10969358 GCATTAAGGAGAAACATCAGGGG + Intergenic
1069268724 10:66496004-66496026 GCAGTAATGACAACAATCTAAGG + Intronic
1072315647 10:94200336-94200358 GCAGTAAGGAGGTGCTTCAACGG + Intronic
1072928008 10:99633772-99633794 GTAGTATGGAGAAGAATCTGCGG - Intergenic
1072988350 10:100164624-100164646 ACAGTAAGGAGAATTTTCTAAGG + Intronic
1075207576 10:120460280-120460302 GCAGGAAGGAGAAGCACTTTTGG + Intronic
1077638068 11:3856644-3856666 GCAGTAAGAAGAAGCCTTTGGGG + Intronic
1078179867 11:9003013-9003035 GCATTAAGTAGAAGCACCTCAGG - Intronic
1078214588 11:9300929-9300951 GCAGTAAGCAGAAGAAAGTACGG + Intronic
1080255779 11:30289005-30289027 GCTGTAATGTGAAGCATCTTTGG - Intergenic
1083988119 11:66230221-66230243 GCACCAGGGAGATGCATCTAGGG + Intronic
1084910605 11:72385130-72385152 GGACTAAGGAGATGCATGTAAGG - Intronic
1087152509 11:94871292-94871314 GCAGTGAGAAGAAGCATCGAGGG + Exonic
1087411590 11:97797193-97797215 GCAGTAAGGTAAAGCATGTTTGG + Intergenic
1089533618 11:119148111-119148133 GCAGTAAGGAGAAGCCTCAGCGG + Intergenic
1092457307 12:8655480-8655502 GCAGTCAGGAAAAGTAGCTAAGG + Intronic
1093607187 12:21106669-21106691 GCAGTAATGATAAACATCTGAGG + Intronic
1098598350 12:72298993-72299015 GCAGTACAGAGAAGAATCTCTGG + Intronic
1100387843 12:94119985-94120007 GAAGAAAGGAGAGGGATCTAAGG - Intergenic
1102856290 12:116297188-116297210 GAAATGAGGAGAAGCATTTAAGG + Intergenic
1103521988 12:121542279-121542301 GCAGTCAGCTGAAGCCTCTATGG - Intronic
1107252734 13:38384572-38384594 GCAGTAAAAAAAAGAATCTATGG - Intergenic
1108589913 13:51903821-51903843 GCAGAAAAGAGAACCATATAGGG + Intergenic
1108687328 13:52832074-52832096 GCAGTAAGGGGAAGCAGGCACGG + Intergenic
1110393877 13:75007693-75007715 GAAGTAAGAAGAAAGATCTAAGG + Intergenic
1111001322 13:82187259-82187281 GCAGTTAGGAAAAACATTTATGG - Intergenic
1114350513 14:21845356-21845378 CCAGTAAGGAGAAAAATCTCAGG - Intergenic
1120165254 14:81191699-81191721 GGATTAGGGAGAGGCATCTAAGG + Intronic
1120351803 14:83370226-83370248 GCAGTAAAGAGAAGCTATTATGG - Intergenic
1120887281 14:89461730-89461752 GTAGTCAGGAGGAGCATCCAGGG + Intronic
1120974105 14:90234011-90234033 GCAGGAAGAAAAAGCTTCTATGG + Intergenic
1202928973 14_KI270725v1_random:22722-22744 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1124119025 15:26872630-26872652 GGGGAAAGGAGAAGCATCAAAGG + Intronic
1126969863 15:54098478-54098500 GGAGGAAGGAGAAGAAGCTATGG - Intronic
1127113296 15:55697959-55697981 GTGGTAAGGAGAAGAATCAATGG - Intronic
1127166564 15:56249769-56249791 GAGGAAAGAAGAAGCATCTATGG + Intronic
1128377963 15:67090709-67090731 GCAGTAAGGAGAAGCATCTAGGG - Intronic
1131637838 15:94256830-94256852 GAAGGAAGGAGAAGTATCAAAGG - Intronic
1132472668 16:114677-114699 GCAATCAGGAGAAGCTTCAATGG + Intronic
1136861431 16:33706826-33706848 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1138878221 16:60979134-60979156 GCAGCAGGGAGATGCAACTAGGG + Intergenic
1203122930 16_KI270728v1_random:1555017-1555039 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1143766164 17:9138911-9138933 GCAGTGAGCAGATGCATCCAGGG + Intronic
1146685491 17:34838743-34838765 GCAATAGGAAGAAGCCTCTAAGG + Intergenic
1148826010 17:50394871-50394893 ACAGGAAGGAGATGCATCCAAGG + Intronic
1149036082 17:52135746-52135768 GCAGTAATGAGAAGCAGAGAGGG - Intronic
1152873600 17:82772820-82772842 GCAGTTATGAGAAACATCTCGGG + Intronic
1156701434 18:39830203-39830225 GAGGGAAGGAGAAGCATCAAAGG - Intergenic
1157329343 18:46692117-46692139 GCAGTGAGGAGAATCATACAAGG + Intronic
1158346822 18:56524397-56524419 CAAGTGAGGATAAGCATCTAAGG - Intergenic
1158495376 18:57950525-57950547 GCAGTAAGGATACACATCTCAGG + Intergenic
1160107765 18:75994339-75994361 GGAGTGATGAGGAGCATCTAGGG - Intergenic
1162856907 19:13475746-13475768 GCAGTGAAGAGAAACATCAATGG + Intronic
1163261186 19:16190966-16190988 CCAGTATGGAGCAGCATCGAGGG + Exonic
1163341438 19:16710083-16710105 GCAGGCAGGAGGATCATCTAAGG - Intergenic
1163644253 19:18479325-18479347 GCAGAAAGCAGAAAAATCTATGG + Intronic
1165705048 19:37969729-37969751 GCAGTCAGGAAAAGCATTTCAGG - Intronic
1166512382 19:43417813-43417835 GCAGCAAGGAGCAACATCTCTGG + Intronic
1202693416 1_KI270712v1_random:106254-106276 GCTCTGAGTAGAAGCATCTAGGG + Intergenic
926854650 2:17241332-17241354 GCATTAAGGAGAAAAATCTGAGG - Intergenic
927093825 2:19732647-19732669 GGAGAAAGGAGAAGCACCCAGGG + Intergenic
928965025 2:36967102-36967124 GCAGAATGGAGGAGCGTCTAGGG - Intergenic
930315968 2:49797238-49797260 GAAGTAAAGAGAAGCAGCCATGG - Intergenic
933143552 2:78823127-78823149 GTAGTAAGCAGATGTATCTAAGG + Intergenic
933953153 2:87348305-87348327 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
934177016 2:89585194-89585216 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
934237384 2:90244650-90244672 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
934287324 2:91659553-91659575 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
934459814 2:94207955-94207977 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
937379217 2:121361383-121361405 TCATTAAGGAGAAGCAATTATGG + Intronic
938435079 2:131278073-131278095 GCAGCCAGGATTAGCATCTAGGG + Intronic
940322096 2:152388408-152388430 GCAGCAAGGAGAAGTATGAACGG + Intronic
942341370 2:174951210-174951232 GCGTTGAGGGGAAGCATCTATGG + Intronic
943040811 2:182802824-182802846 TCAGTATGGAGAAGGATCTCAGG - Intergenic
944302356 2:198138298-198138320 GCAGGAAAGAGAAACAGCTAAGG + Intronic
944867630 2:203878094-203878116 GGACTTAGGAGAAGCATCTCAGG + Intergenic
945221817 2:207491158-207491180 GAAGTAATGATAAGCATTTAAGG - Intergenic
945822269 2:214679334-214679356 TCAGAAAAGAGAAGCAACTATGG + Intergenic
947632580 2:231663566-231663588 GCAGTGGGGAGAAGCAGCTGGGG + Intergenic
947837859 2:233188303-233188325 GCAGGGAGGAGAACTATCTAGGG - Intronic
1170557896 20:17530381-17530403 GCAGTAAAGATAAGTATGTAAGG + Intronic
1172592642 20:36128363-36128385 CCAGGAATGAGCAGCATCTAAGG - Intronic
1175103688 20:56598613-56598635 ACATTAAGGAGAAGCATTTTGGG - Intergenic
1176308695 21:5138035-5138057 TCAGGAAGCGGAAGCATCTAAGG - Intronic
1176590994 21:8651309-8651331 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1176983614 21:15410929-15410951 GGAGTCAGGAGAAGCAGCTATGG + Intergenic
1177097945 21:16861667-16861689 GCAGTAGGCAGAAGCATCAATGG + Intergenic
1177820978 21:26030671-26030693 GAATTAAGGAGAAGCACCTAAGG + Intronic
1179035049 21:37752502-37752524 GCATTAAGCAGAAGCTTTTAAGG + Intronic
1179200269 21:39211998-39212020 GGGGTAAGGAGAAGGGTCTATGG - Intronic
1179848364 21:44123997-44124019 TCAGGAAGCGGAAGCATCTAAGG + Intronic
1180273822 22:10628342-10628364 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1180628984 22:17214169-17214191 CCAGTAGGGAGCAGCATCGAGGG + Intronic
1181356396 22:22298544-22298566 GCTCTGAGTAGAAGCATCTAGGG + Intergenic
1181959293 22:26611344-26611366 GGAGTAATGATAAGCATCTGTGG - Intronic
1183299227 22:37050748-37050770 CCAGTAAGGAGAGGAAGCTAAGG + Intergenic
950520601 3:13495584-13495606 GCAGCAAGGAGAACCAATTAGGG - Intronic
950804356 3:15585320-15585342 GCAGTGAGAAGCAGTATCTATGG - Exonic
951601446 3:24380538-24380560 GCAGTATGGTTAAGCATTTAGGG - Intronic
952901849 3:38116148-38116170 GCCGGAAGGAGAAGCAGCTGTGG + Intronic
956251524 3:67239174-67239196 GCAAGAAGAAGAAGCATTTATGG - Intergenic
957990893 3:87626199-87626221 GCAGTAAGGATAAGGATAAAAGG - Intergenic
958731688 3:97966733-97966755 GCAGTAAAGGGAAGCAACTTCGG + Intronic
959590357 3:108073463-108073485 GCAGTAAGGAAAGGCCTCTAGGG + Intronic
959651778 3:108757341-108757363 GCAGTTTGGAGAAGCAGGTAGGG + Exonic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
962431981 3:135328329-135328351 GCTGTAAGGAGAATCATATGGGG + Intergenic
967043896 3:185718916-185718938 GCTGTAAGGAGCAGCTTCTTGGG - Intronic
968213249 3:196867282-196867304 GCAGTAAGGATATGCATTGATGG - Intergenic
974105350 4:57463577-57463599 TCAGTAAGTAGAAGTTTCTAAGG + Intergenic
976401536 4:84612257-84612279 GCAGTAAGGAGAAGTATTTTGGG + Intronic
977276958 4:94989623-94989645 TTAGTAAGGAGAAGCAGCTTTGG - Intronic
978115425 4:105014741-105014763 GAAGTAAGGAGAATCATATAAGG - Intergenic
979681561 4:123465839-123465861 GCAGCCAGGAGAAGAATCTGAGG + Intergenic
982092515 4:151892684-151892706 GCAGCATGGAGAAACACCTAGGG + Intergenic
982278962 4:153664660-153664682 GCAGTATGGAGAAGGTGCTACGG + Intergenic
983076940 4:163337823-163337845 CCAGGAAAGAGAAGCAGCTAGGG - Intronic
986952438 5:13105831-13105853 GGAGTAAGAGGAAGCTTCTAGGG + Intergenic
988263851 5:28926663-28926685 GCTTTGAGTAGAAGCATCTAGGG + Intergenic
992042054 5:72845144-72845166 GTAGTATGGAGTATCATCTAAGG + Intronic
995594021 5:113729675-113729697 GCAGTAAAGACAGGCATCTTGGG + Intergenic
996489901 5:124081675-124081697 GAAGTAAAGAGAACCTTCTAAGG - Intergenic
998773078 5:145568058-145568080 GCAGAAAGGAGAAGCACAGAAGG + Intronic
1005197489 6:23305472-23305494 GCAGTAAGGATCATCATCCAAGG + Intergenic
1005363210 6:25052413-25052435 GAAGCAAGGAGTAGCACCTAGGG - Intergenic
1006175168 6:32117107-32117129 TCTGGAAGGAGAAGTATCTAAGG + Exonic
1006280521 6:33049554-33049576 GCTGTAAAGAGTTGCATCTATGG - Intergenic
1007395939 6:41577891-41577913 GCAGTAAGGAGAAGGAGATCAGG - Intronic
1011154851 6:84319621-84319643 CTAATAAGGAGAAGAATCTATGG + Intergenic
1012417891 6:99029729-99029751 GGAGAAAGGAGCAGCAACTAGGG - Intergenic
1012513940 6:100036885-100036907 GCAGTAAGGGGGAGGATCAAAGG + Intergenic
1012927070 6:105278364-105278386 GCAGTGAGGAGCAGCATGGACGG + Exonic
1013165359 6:107585470-107585492 GCAGTAAGAAGAAACATCATTGG + Intronic
1017654787 6:156617308-156617330 GCAGAAAGGAGAGGAATTTAAGG + Intergenic
1017978681 6:159379660-159379682 GCTGTCAGGAGTGGCATCTAGGG - Intergenic
1019258706 7:67855-67877 GGAGGAAGGTGAAGCCTCTATGG + Intergenic
1020911917 7:14141923-14141945 GCAGTAAGGAGAGGCCACTGTGG - Intergenic
1024476379 7:49816398-49816420 GCACTAAGGAGATACATCAAAGG + Intronic
1026743640 7:72994651-72994673 GCGGCAAGCAGAAGCATTTAGGG - Intergenic
1026783723 7:73286123-73286145 GCGGCAAGCAGAAGCATTTAGGG - Intergenic
1026803554 7:73415316-73415338 GCGGCAAGCAGAAGCATCTAGGG - Intergenic
1027029746 7:74879349-74879371 GCGGCAAGCAGAAGCATTTAGGG - Intergenic
1027100095 7:75370426-75370448 GCGGCAAGCAGAAGCATTTAGGG + Intergenic
1030968011 7:116017708-116017730 GCAGTAGGGAAAAGCATAAATGG - Intronic
1032131067 7:129228241-129228263 GAAGTAAGGAAAACCATCTATGG - Intronic
1032808685 7:135385296-135385318 GCAGTAAGGAGATCCAGCTGAGG - Intronic
1033555579 7:142486015-142486037 GGAGGGAGGAGAAGCAACTAAGG + Intergenic
1034467558 7:151238846-151238868 TGAGTAAGGAGAAGAATCCAAGG + Intronic
1035920146 8:3667865-3667887 GCAGTGAGTAGAAGCAGCCAAGG + Intronic
1038241986 8:25818462-25818484 GAAGGAAGGAGAAAGATCTATGG - Intergenic
1038399063 8:27269291-27269313 GCAGTAGGGAGAGGCAGCTGTGG - Intergenic
1043736574 8:83754349-83754371 GCAGTCAGGACAATGATCTAAGG + Intergenic
1046460523 8:114528200-114528222 GCAGGAAGCAGAAGAATCCAGGG + Intergenic
1047505355 8:125475353-125475375 GCAGCCAGGAGAGGCAACTAAGG + Intergenic
1048638027 8:136320981-136321003 GAAGGAAGGTGAAGCAACTACGG + Intergenic
1050174153 9:2852595-2852617 GCAGTCAGGAGAGGCATCTGGGG + Intergenic
1050208864 9:3230975-3230997 GTATTAAGTAGAAACATCTAAGG - Intronic
1050247159 9:3702971-3702993 GCAGTAAGGAGCAACCTTTATGG - Intergenic
1051076547 9:13244761-13244783 GAAGTAATGAGAAGGATCTGAGG + Intronic
1052786690 9:32834895-32834917 GCAGTATGGAGAGGCCTTTAAGG + Intergenic
1053690314 9:40583763-40583785 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1054301565 9:63384724-63384746 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1054919526 9:70528051-70528073 GAAGTACAGAGAAGCATATATGG - Intergenic
1057896232 9:98911202-98911224 GCAGCAGGGAGAAGGGTCTATGG - Intergenic
1061469825 9:130815623-130815645 GCTGTAGGGAGAAGAAACTAAGG - Intronic
1203621009 Un_KI270749v1:130033-130055 GCTCTGAGTAGAAGCATCTAGGG - Intergenic
1185977993 X:4742856-4742878 TCAGAAAGGTGAAGCAGCTACGG - Intergenic
1188653836 X:32665910-32665932 GCAGTGTGGAGAATGATCTATGG + Intronic
1189543359 X:42016023-42016045 GCTGTAAGGAGAAACCTGTAAGG + Intergenic
1190501370 X:51081862-51081884 GCTGTAAGGAGTAGAATCTGGGG + Intergenic
1199691977 X:150315505-150315527 GCAGTAAAGAGCTGCATCAAAGG + Intergenic