ID: 1128378806

View in Genome Browser
Species Human (GRCh38)
Location 15:67096172-67096194
Sequence CAATATAAGTGGTTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128378806_1128378814 13 Left 1128378806 15:67096172-67096194 CCTGACACCAACCACTTATATTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1128378814 15:67096208-67096230 AAGAAGGGAAAGGAAAGATAGGG 0: 1
1: 3
2: 35
3: 526
4: 5794
1128378806_1128378812 3 Left 1128378806 15:67096172-67096194 CCTGACACCAACCACTTATATTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1128378812 15:67096198-67096220 ATGATGACGGAAGAAGGGAAAGG 0: 1
1: 0
2: 1
3: 45
4: 536
1128378806_1128378809 -10 Left 1128378806 15:67096172-67096194 CCTGACACCAACCACTTATATTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1128378809 15:67096185-67096207 ACTTATATTGAAAATGATGACGG 0: 1
1: 0
2: 2
3: 30
4: 404
1128378806_1128378811 -2 Left 1128378806 15:67096172-67096194 CCTGACACCAACCACTTATATTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1128378811 15:67096193-67096215 TGAAAATGATGACGGAAGAAGGG 0: 1
1: 0
2: 1
3: 37
4: 355
1128378806_1128378810 -3 Left 1128378806 15:67096172-67096194 CCTGACACCAACCACTTATATTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG 0: 1
1: 0
2: 2
3: 21
4: 242
1128378806_1128378813 12 Left 1128378806 15:67096172-67096194 CCTGACACCAACCACTTATATTG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1128378813 15:67096207-67096229 GAAGAAGGGAAAGGAAAGATAGG 0: 1
1: 2
2: 13
3: 368
4: 2647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128378806 Original CRISPR CAATATAAGTGGTTGGTGTC AGG (reversed) Intronic
903644850 1:24888641-24888663 CAACATAAGTGGGTGGCGTGGGG + Intergenic
905280950 1:36849197-36849219 CCATATATGTGCTTGGTGGCTGG - Intronic
907484909 1:54770778-54770800 CAAAAGAAGTTGTTGGTGGCTGG - Intergenic
917632094 1:176900518-176900540 CAAGAGAAGTGGATGGTGTGGGG - Intronic
919249712 1:195037568-195037590 CAGTATAAGTAGTGGGTGTATGG + Intergenic
924376175 1:243411684-243411706 TAATATATGTCTTTGGTGTCTGG + Intronic
924515076 1:244759398-244759420 CAAAGTATGGGGTTGGTGTCTGG + Intergenic
1066328270 10:34388788-34388810 AAATAAAAGAGGTAGGTGTCAGG + Intronic
1068349464 10:55823796-55823818 CATTATAAGTGGTAGTGGTCAGG + Intergenic
1070386399 10:75928725-75928747 CCACATGAGTGGTTTGTGTCAGG - Intronic
1070560880 10:77565730-77565752 CAAGATAAGTGGTTAGTAACTGG + Intronic
1072068305 10:91891759-91891781 CTATCTAAGGGGTTGGTGCCTGG + Intergenic
1072342547 10:94468580-94468602 CAATATAAGTGCTTTTTTTCTGG + Intronic
1072839090 10:98750574-98750596 CGGTAGAAGTGGTTGGTTTCTGG + Intronic
1079278135 11:19060841-19060863 CAAGATAAGTGATTGGAGTCAGG - Intergenic
1082977879 11:59092926-59092948 CAATATAGATTGTAGGTGTCTGG + Intergenic
1086600132 11:88623424-88623446 CAATATAAGTGGTCTCTGGCCGG - Intronic
1088540959 11:110913224-110913246 CAACAGAAGTTGATGGTGTCTGG + Intergenic
1090043804 11:123313614-123313636 CAATATTAGTGGTTGTGGTGGGG + Intergenic
1096063452 12:48721106-48721128 CATTTTAAGTGGATGGTGGCAGG + Intergenic
1102160272 12:110763228-110763250 CAATGTAAGTGGTTGGAATTTGG + Intergenic
1103324545 12:120111746-120111768 CAGTGTCAGAGGTTGGTGTCAGG - Intronic
1104505432 12:129327662-129327684 GAAGATAAGTGGAAGGTGTCAGG - Intronic
1106634051 13:31508457-31508479 CAATAGAGGTGGCTGGTTTCAGG + Intergenic
1107583625 13:41819630-41819652 CAAAAGCAGTGGTTCGTGTCAGG - Intronic
1108072803 13:46646472-46646494 AAATATAAGTAGATTGTGTCTGG - Intronic
1110159797 13:72361833-72361855 TATTTTAAGTGGTTGGTATCTGG - Intergenic
1110605924 13:77432514-77432536 AAATATAATTAGTTGGTGGCTGG + Intergenic
1111804213 13:93019083-93019105 CAATATTTGTGGATGGTGTGAGG - Intergenic
1112122012 13:96423393-96423415 AAATAAAAGTGGATGCTGTCAGG + Intronic
1116794236 14:49373060-49373082 CTATATAAGTAGTTGTTGTATGG + Intergenic
1120097445 14:80404263-80404285 CCTTATATGTGGATGGTGTCAGG + Intergenic
1121977054 14:98414712-98414734 CAACAACAGTGGTTGGTGTCTGG - Intergenic
1126227060 15:46282927-46282949 CAAGATAAGTGGTTGGTTGTGGG + Intergenic
1126860611 15:52879159-52879181 CAACACAAGTGGTTTGTGTGAGG - Intergenic
1128378806 15:67096172-67096194 CAATATAAGTGGTTGGTGTCAGG - Intronic
1131010919 15:89017790-89017812 CAATTTAGGTGGTTGGGGTTGGG - Intergenic
1133683823 16:8146983-8147005 GAATATAAGTGATTGGGGCCAGG + Intergenic
1137421920 16:48342087-48342109 CAATATACCTGGTTGGGGACAGG + Intronic
1139441171 16:66968053-66968075 CATTAAAAGTGGTTGTTGGCTGG - Intronic
1150954239 17:69838611-69838633 TATTATCAGTGGTTGGGGTCGGG + Intergenic
1155360064 18:24990979-24991001 AAATATCAGTGGCTGGTGACGGG - Intergenic
1155403807 18:25466044-25466066 TAATAAAAGAGGTTAGTGTCTGG - Intergenic
1157022083 18:43795811-43795833 CAATATTAGTGGGAGGTTTCAGG + Intergenic
1158179169 18:54693888-54693910 TAATATTAGTTGTAGGTGTCAGG + Intergenic
1158552512 18:58448271-58448293 AATTAAAAGTGGTTAGTGTCAGG - Intergenic
1159401634 18:67944232-67944254 CACTATGATTGGTTTGTGTCTGG - Intergenic
1159760257 18:72416989-72417011 CAAAATAAGTGTTTGTTGTGTGG + Intergenic
925690449 2:6517403-6517425 CAAGATATGTGCTTGGTGACAGG - Intergenic
925803762 2:7628308-7628330 CATCGTAAGTGGTTGGTGGCAGG + Intergenic
926352817 2:12012313-12012335 CCAAATAAGTGTTTGGTGTGAGG + Intergenic
926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG + Intergenic
926776863 2:16431764-16431786 CAATATCAATGGTTGGAGACCGG - Intergenic
931102959 2:59023001-59023023 CCATATAAGTGGTAAGTGGCAGG + Intergenic
933343909 2:81058987-81059009 CAATATTAGTGTTTGGTATTTGG + Intergenic
936289205 2:111206718-111206740 TAATATTAGTGTTTGGTGTGAGG + Intergenic
942945714 2:181670388-181670410 CAGTATACGTAGTTGGTATCGGG - Intronic
947708635 2:232296390-232296412 TAATTTAAGTGGTTTTTGTCAGG + Intronic
1169031078 20:2407524-2407546 CAAGATAATTGCTTGCTGTCAGG + Intronic
1172761590 20:37327180-37327202 CAATAAGAGTGGCTGTTGTCAGG + Intergenic
1175081948 20:56428193-56428215 GAGCATAAGTGTTTGGTGTCAGG + Intronic
1176257743 20:64160909-64160931 CCATATAGCTGGTGGGTGTCAGG + Intronic
1184791980 22:46705730-46705752 CAAGACAAGTGGTGGGTGACTGG + Intronic
949455126 3:4230199-4230221 CAGGACAACTGGTTGGTGTCTGG - Intronic
972611466 4:40659458-40659480 CAATGTAAGTGGCTGAGGTCAGG - Intergenic
973665538 4:53155109-53155131 TAATACAAGTGGTTGATGTGAGG + Intronic
974693314 4:65330868-65330890 CAAGCTGAGTGGTTGGTTTCAGG + Intronic
976610074 4:87021335-87021357 CAAGATAAATGAGTGGTGTCTGG - Intronic
978083688 4:104623921-104623943 CAATATAAGGGCTTGGTTTAAGG - Intergenic
978653420 4:111036876-111036898 GCATATAAGTGGTTTGTGTTTGG + Intergenic
979653335 4:123162139-123162161 CTATAAAAGTGGATTGTGTCCGG + Intronic
980903746 4:138928958-138928980 GAATATAAGAGGTTGGGGTGCGG - Intergenic
981661557 4:147173456-147173478 CAAGATGAGTTGGTGGTGTCAGG - Intergenic
984619814 4:181939689-181939711 CTATATAAGGGGTTGGGGTGCGG + Intergenic
984807814 4:183767449-183767471 GAATATAAGTGGTAGATATCTGG - Intergenic
985179355 4:187239844-187239866 TAATAGAAATGGTTGGTGTGGGG + Intergenic
987102713 5:14606179-14606201 CATTTTATGTGGTTGGTGGCAGG + Intronic
987733245 5:21805001-21805023 CAATATAAGTGGTCTATGTTAGG + Intronic
988256937 5:28832041-28832063 CAAGGTAAGTGTTGGGTGTCTGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993865634 5:93191255-93191277 TTATTTAAGTGGTTGGTGTCTGG - Intergenic
997497892 5:134345855-134345877 CAAAATCAGTGGGTGCTGTCAGG - Intronic
998123945 5:139603200-139603222 AATTAAAAGTGGTTGGAGTCAGG + Intronic
999011260 5:148043213-148043235 AAATACAATTTGTTGGTGTCTGG - Intronic
999441084 5:151601450-151601472 CAATTTGAGTGGCTTGTGTCTGG - Intergenic
999543812 5:152604525-152604547 CACTGTCAGTGGTTGCTGTCTGG + Intergenic
1009240331 6:61178433-61178455 CAATATAACTGGATGATGTAGGG - Intergenic
1009269481 6:61600170-61600192 GAATATGAGTGGTAAGTGTCAGG + Intergenic
1012170350 6:96009214-96009236 TAAAATAAGTGGTTGGTCTTAGG + Intergenic
1013948954 6:115756239-115756261 CTATATCTGTGGTTGGTGTTCGG - Intergenic
1018495605 6:164343454-164343476 CGATATAAGAGGTTGGGGTGCGG + Intergenic
1019777072 7:2918251-2918273 CAGGACAAGGGGTTGGTGTCTGG - Intronic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1028000020 7:85482505-85482527 CAATATAAGTTGTAGGTTTTAGG + Intergenic
1031829622 7:126610398-126610420 CAAGAAAAGGGATTGGTGTCAGG - Intronic
1036718860 8:11153858-11153880 GATGATAAGTGGTTGGAGTCTGG - Intronic
1043122660 8:76347969-76347991 CAAGATAGGTGATTGGAGTCCGG + Intergenic
1044979005 8:97696017-97696039 GATTAGAAGTGGTTGGTGTAAGG + Intronic
1047400776 8:124545325-124545347 CTATAGAAGTGTTTGGTGTAAGG + Intronic
1047832733 8:128654360-128654382 TAATATAAATGGTTGGAGTCAGG + Intergenic
1052380620 9:27767075-27767097 CTAGATAAGTCTTTGGTGTCGGG + Intergenic
1055207885 9:73754467-73754489 CAATTCAAGTTGTTGGTTTCTGG + Intergenic
1059667247 9:116460142-116460164 CAATATATGTCCTTTGTGTCTGG - Intronic
1060330052 9:122659869-122659891 CAAAAAAAGTGGTTGGGGCCGGG - Intergenic
1185556211 X:1023183-1023205 CAATATCAGGGGTTGGGGTGAGG + Intergenic
1186598558 X:11010718-11010740 CAATGGAAGTGGTAGGTGTGTGG - Intergenic
1186769209 X:12801124-12801146 CAAAACAAGTGGCTGGTGGCTGG + Intronic
1187583200 X:20631203-20631225 AAATGTAAATGGTTGGTGTCAGG + Intergenic
1188087489 X:25918540-25918562 AAATATAAGTGGTGGGTATATGG + Intergenic
1189568379 X:42268492-42268514 CAATGTCAGTGCTTGATGTCAGG - Intergenic
1191673246 X:63768793-63768815 CATTTTAAGTGGATGGTGGCAGG - Intronic
1195374595 X:104214576-104214598 CAATGGAAGTGGCTGGTGGCTGG - Intergenic