ID: 1128379819

View in Genome Browser
Species Human (GRCh38)
Location 15:67104400-67104422
Sequence TCTAGGAAGGGCCTGCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128379819 Original CRISPR TCTAGGAAGGGCCTGCCCTC AGG Intronic
900203472 1:1421365-1421387 CTTAGGAAGGCCCTGCCTTCGGG + Exonic
900511232 1:3062099-3062121 CCTAGGTGGGGCCTGCCCTGGGG - Intergenic
900589700 1:3454234-3454256 TGTAGAAAGGCCCGGCCCTCTGG - Intergenic
900651459 1:3732117-3732139 TCAAGGAAGAGCAAGCCCTCTGG + Intronic
901233408 1:7653832-7653854 GCTTGGCAAGGCCTGCCCTCAGG + Intronic
901915198 1:12493985-12494007 TCTAGGAAGAGTATGCCTTCTGG + Intronic
903888899 1:26556867-26556889 TCTCGGAATTGCTTGCCCTCAGG - Intronic
903994925 1:27299795-27299817 TCTAGGAAGGGTGAGCCCTGGGG + Intronic
904007823 1:27373173-27373195 ACTGGGAGGGCCCTGCCCTCAGG + Exonic
904120326 1:28193947-28193969 ATTAGGAAAGGCCTGCCCCCGGG + Intergenic
904541168 1:31234317-31234339 TCCAGCAGGGGCCTGCACTCTGG - Intronic
905252282 1:36657320-36657342 TCCAGGCAGGGCATGGCCTCAGG + Intergenic
909352022 1:74665238-74665260 TCTGGTGAGGGCCTGCTCTCTGG - Intronic
910318243 1:85913988-85914010 TCTAGTGAGGGCCTGCTCCCTGG + Intronic
910483317 1:87682596-87682618 TCTAGGAAGAGGTTGCCTTCTGG - Intergenic
911522417 1:98944523-98944545 TCTGGCAAGGGCCTGCTTTCTGG - Intronic
913212395 1:116592412-116592434 TCAAAGCAGGGCCTGGCCTCTGG - Intronic
915607883 1:156965246-156965268 TCTAGGAAAGGCTTTCCTTCAGG - Intronic
916386714 1:164281413-164281435 TCTAAAAAGGATCTGCCCTCAGG + Intergenic
917286229 1:173424092-173424114 TCCAGGAAGGCTCTGCTCTCAGG + Intergenic
920113231 1:203601551-203601573 GCTAGGAAGGCTCTGCCCTCAGG - Intergenic
922330497 1:224571289-224571311 TTTAGGAGAGGCCTGCCCTGAGG + Intronic
922360659 1:224818662-224818684 TCCAGGAAGGACCCACCCTCAGG + Intergenic
922521377 1:226255292-226255314 TCTTAGCAAGGCCTGCCCTCAGG + Intronic
923670399 1:236035669-236035691 CCTAGGCAGGGGCTGCCATCCGG + Intronic
1063033174 10:2256499-2256521 TCTAGGATGAGACAGCCCTCAGG - Intergenic
1063077650 10:2732917-2732939 TCCGGGAAGGACCAGCCCTCAGG + Intergenic
1065483157 10:26214260-26214282 TCTAGGGAGGGACAGCCTTCAGG + Intergenic
1066019511 10:31283927-31283949 TCTGGGGAGGACCTGCCTTCTGG - Intergenic
1066498335 10:35964614-35964636 TCTTGAAAAGGCCTGCCCACAGG + Intergenic
1066626052 10:37406886-37406908 TCTTGAAAAGGCCTGCCCACAGG + Intergenic
1067686315 10:48467926-48467948 TCTAGGCAGAGCCTGGCCTAGGG + Intronic
1068788489 10:61001826-61001848 TCCAGGAAGGGCGGCCCCTCGGG - Intergenic
1071495865 10:86167321-86167343 TCTTGGTGGGGCCTGCACTCAGG - Intronic
1071814719 10:89220693-89220715 ACTAGGAAGAGCCTGGCCTGAGG - Intronic
1072251514 10:93585784-93585806 TGTGGGAAGGGCCTGCCCATGGG - Intronic
1074438178 10:113452345-113452367 CCTAAAAAGGGCCTTCCCTCAGG + Intergenic
1075128497 10:119720276-119720298 TCTGGTGAGGGCCTGCTCTCTGG + Intergenic
1075649776 10:124119786-124119808 ACTGGGAAAGGCCTGGCCTCAGG - Intergenic
1076634092 10:131871704-131871726 TCCATGCAGGGCCTGCCCTTGGG + Intergenic
1076982944 11:214641-214663 CCCAGGTAGGCCCTGCCCTCAGG - Exonic
1078315469 11:10289892-10289914 TCTGGGCAGGACCTGCCCTCAGG - Intronic
1080025056 11:27604661-27604683 TCTGGTGAGGGCCTGCCTTCTGG - Intergenic
1080199386 11:29650735-29650757 TCTAGTAAGGGCCTGCTTTCTGG - Intergenic
1083354576 11:62056662-62056684 TCTGGGGAGGGCCTGCTTTCTGG - Intergenic
1083355503 11:62063263-62063285 TCTGGGGAGGGCCTGCTTTCTGG - Intergenic
1086424821 11:86672670-86672692 TCGGGGAAGGGCGTGCCTTCAGG + Intergenic
1088193041 11:107247256-107247278 CCAAGGAAGGGCCTGGCCTGTGG - Intergenic
1088708309 11:112483282-112483304 TATAGGAAGTGTCTGGCCTCTGG + Intergenic
1090161239 11:124497859-124497881 TTTAGGACTGGCCTGTCCTCTGG - Intergenic
1091651806 12:2316045-2316067 TCCATGAAGGTGCTGCCCTCTGG - Intronic
1091662935 12:2398021-2398043 TCAAGCCTGGGCCTGCCCTCGGG - Intronic
1094442878 12:30498703-30498725 TCTGGTGAGGGCCTGCCTTCTGG - Intergenic
1095111449 12:38298517-38298539 TCTAGAAAGGGAATACCCTCAGG + Intergenic
1095297085 12:40539073-40539095 TCTAGGAAGGGAAAGCCTTCAGG - Intronic
1096219011 12:49816181-49816203 ACAAGGAAGGGCCTCTCCTCGGG - Intronic
1096975811 12:55698752-55698774 TCTGGGGAGCGCCTGACCTCCGG - Exonic
1098535703 12:71591700-71591722 AGTAGGAAGTGCATGCCCTCAGG - Intergenic
1099893188 12:88614068-88614090 TCTGGTGAGGGCCTGCCTTCTGG + Intergenic
1101955289 12:109207267-109207289 TTTATGAAGGACCTGTCCTCAGG + Intronic
1111117642 13:83801826-83801848 TCTAGTAAGGGCCTGTCCCGTGG - Intergenic
1111812204 13:93105045-93105067 TCTGGGGAGGGCCTGCGTTCTGG - Intergenic
1113693241 13:112326682-112326704 TCTAGGGAGGCCGTTCCCTCCGG - Intergenic
1116956832 14:50932568-50932590 TCTTGGAATGGCCTTACCTCTGG + Intronic
1117029077 14:51651369-51651391 TCTCGGAGTGGCCTCCCCTCCGG + Intronic
1117141006 14:52791354-52791376 GCTGGGGCGGGCCTGCCCTCAGG - Intronic
1118620345 14:67609345-67609367 TCTGGGAAGGTCCTGAGCTCAGG + Intergenic
1119161767 14:72458726-72458748 TCTGGTGAGGGCCTGCTCTCTGG + Intronic
1119706034 14:76783093-76783115 TCTGGGAAGAGCCTGACCTGAGG + Intergenic
1122807365 14:104266708-104266730 GCTGGGAAGGGCCTGCTCTCTGG + Intergenic
1124011873 15:25845483-25845505 TCTTGTAAGGCCCTGCTCTCTGG - Intronic
1125256988 15:37775999-37776021 TCTGGGAAGGGCATGACCTTGGG - Intergenic
1126541404 15:49828442-49828464 TCTGATAAGGGCCTGCTCTCTGG + Intergenic
1127259616 15:57318676-57318698 TCTAGTAAGGGCCTGATTTCTGG - Intergenic
1127871830 15:63080364-63080386 TCCAGGAAGTGCCTGCCCAGTGG + Intergenic
1128379819 15:67104400-67104422 TCTAGGAAGGGCCTGCCCTCAGG + Intronic
1129283230 15:74502429-74502451 CCCAGGAAGGGCATGACCTCAGG + Intergenic
1129411965 15:75355279-75355301 GGTAGGAAGGGCCTGCTGTCCGG + Exonic
1130841686 15:87706737-87706759 TCTGGGAAGGCCCTGCAATCTGG + Intergenic
1131372354 15:91893435-91893457 TCTGGTAAGGGCCTGCTTTCTGG + Intronic
1132579728 16:679474-679496 GCTACGGAGGCCCTGCCCTCGGG + Intronic
1132734262 16:1377785-1377807 TCTGGGAAGGGCCTGCAGTGGGG - Intronic
1132905204 16:2278912-2278934 TCTGGGAAGGGCCAGGGCTCGGG + Intronic
1132908410 16:2296106-2296128 TCTAGGAAGGGACTGTCAGCAGG + Intronic
1133190728 16:4131814-4131836 TCCAGGAAGGGCCGGCACTGGGG + Intergenic
1133212411 16:4271091-4271113 TCGTGCAAGGGCCAGCCCTCGGG + Intronic
1133312760 16:4860962-4860984 TCTCGGAAGGGACTTCCTTCTGG - Exonic
1135835125 16:25818364-25818386 TCTAGCAAGGGCCTGCTTTCTGG - Intronic
1136019783 16:27432746-27432768 TCTAGGAGGGGGCTTTCCTCAGG - Intronic
1137292076 16:47058645-47058667 TCTGGAAAGGTCCTGCGCTCGGG + Intergenic
1137402223 16:48163023-48163045 TCTAGGCTGGGGCTGCCCTCTGG + Intergenic
1137550639 16:49435168-49435190 TCTAGGAAGACCCTGGGCTCAGG - Intergenic
1137580315 16:49629845-49629867 TCTAGGTAAGGCCTGCGCTAGGG - Intronic
1138457905 16:57131882-57131904 TCGGGGAGTGGCCTGCCCTCTGG + Intronic
1139671801 16:68497335-68497357 TATAGGAAGGACCGGCCATCTGG - Intergenic
1140393892 16:74610854-74610876 TTTAGTAAAGGCCTGACCTCAGG - Intergenic
1140750449 16:78018738-78018760 TCTAGAAAGGTCCTGCCCTGTGG - Intergenic
1141107724 16:81247328-81247350 TCTAGCAAGGGCCTGACACCTGG + Intronic
1141592191 16:85076713-85076735 GGCAGGAAGGGCCTGCCCACTGG - Intronic
1142325958 16:89414743-89414765 TCTAGGCTGGTCCTGCCCTGAGG - Intronic
1144205570 17:12977385-12977407 GCAAGGAAGGGCCTGCCATCAGG - Intronic
1145103099 17:20093210-20093232 TCTGGCAAGGGCCTGCTGTCTGG + Intronic
1145878183 17:28335544-28335566 TGTAGGCCGGGCCTCCCCTCGGG - Intergenic
1146741526 17:35288248-35288270 ACTGAGAAGTGCCTGCCCTCAGG + Intergenic
1147042547 17:37729908-37729930 TCTAGGAAGGGCGTGTCCCATGG - Intronic
1147169003 17:38607260-38607282 GCTGGGAAGGGCCTCTCCTCTGG - Intergenic
1147270992 17:39271175-39271197 TCTAGGAGCAGGCTGCCCTCTGG - Intronic
1148747843 17:49928261-49928283 GCTAGGACGGCCCTGCCCTCCGG + Intergenic
1149239750 17:54635398-54635420 ACTAGGTAGGGCTTGGCCTCAGG - Intergenic
1150007552 17:61479200-61479222 CCTGGGAAGGGCCTCCGCTCAGG - Intronic
1150415375 17:64983926-64983948 TCTGGGGAGGGCCTGCTTTCTGG - Intergenic
1150796298 17:68240110-68240132 TCTGGGGAGGGCCTGCTTTCTGG + Intergenic
1153316596 18:3728853-3728875 TCTTGGAAGTCCCTCCCCTCTGG + Intronic
1153756163 18:8285579-8285601 CCAAAGAAGGGCCTGGCCTCAGG + Intronic
1155043132 18:22081916-22081938 TCTAGGGAGGGCCTGCTTCCTGG + Intergenic
1155839872 18:30631366-30631388 TCCAGGAAGGACTTGGCCTCAGG - Intergenic
1155864045 18:30942203-30942225 ACTAGAAAGAGCCTGGCCTCTGG + Intergenic
1156524157 18:37750612-37750634 TCTAGGTAGGGGGTGCCTTCTGG + Intergenic
1156786739 18:40924044-40924066 TCTGGTAAGGGCCTGCTTTCTGG - Intergenic
1157148396 18:45189877-45189899 ACTAGGATGGGACTGCCCTAGGG - Intergenic
1158125470 18:54095600-54095622 TCTGGTAAGGGCCTGCTTTCTGG - Intergenic
1160800950 19:968512-968534 TCCAGGCAGGGCGTGGCCTCAGG - Intronic
1161292997 19:3505922-3505944 CCTAGGAAGGGTCTGCCCTGGGG + Intergenic
1161750120 19:6089648-6089670 TCTGGGGAGGGCCTGCTTTCTGG - Intronic
1165170276 19:33887494-33887516 TGTGGGCAGGGCCTGGCCTCAGG + Intergenic
1166047020 19:40235704-40235726 TCAAGGATGGGCCTGCCCTGGGG + Intronic
1167766792 19:51488670-51488692 TCCAGGAGGGGCCTGCCCCCAGG - Intronic
925237700 2:2293695-2293717 TCTGGGAAGGACCTGCCCCTCGG + Intronic
925844110 2:8020376-8020398 TCTGGGCAGGGTCTTCCCTCTGG - Intergenic
927110350 2:19860118-19860140 CCTAGGAGGGGCAGGCCCTCTGG - Intergenic
927485847 2:23487966-23487988 GCTAGAAGGGGCCTCCCCTCGGG - Intronic
930277416 2:49329534-49329556 TCCAAGAAGGGCATGACCTCAGG - Intergenic
931821525 2:65956860-65956882 TCTTGTAAGGGCCTGCCTTCTGG - Intergenic
932130651 2:69184312-69184334 TTTAGGATAAGCCTGCCCTCTGG + Intronic
932197731 2:69798611-69798633 GCTGGGGAGGACCTGCCCTCAGG - Intronic
934158966 2:89230214-89230236 TATGGGAAGGACCTGCCCACAGG - Intergenic
934208309 2:89952211-89952233 TATGGGAAGGACCTGCCCACAGG + Intergenic
934607516 2:95708355-95708377 TTTTGTAAGGGCCTGCCCTCAGG - Intergenic
936540910 2:113350546-113350568 TTTTGTAAGGGCCTGCCCTCAGG - Intergenic
936761665 2:115792818-115792840 TCAAGGAAGGGACATCCCTCAGG + Intronic
937450860 2:122001144-122001166 TCTAGGAACGGGATGCCCTCAGG + Intergenic
938079597 2:128362717-128362739 TTCAGGAAGGCCCAGCCCTCAGG - Intergenic
940853155 2:158707205-158707227 TCTAAACAGGGCCTGACCTCAGG + Intergenic
943642651 2:190376046-190376068 TCTGGTAAGGGCCTGCTTTCTGG - Intergenic
944577788 2:201106295-201106317 TCTGGTGAGGGCCTGCCTTCTGG - Intergenic
944670859 2:201993278-201993300 TCTAGTGAGGGCCTGCTCTCTGG - Intergenic
945524752 2:210874418-210874440 TCTAGTAAGGGCCTGCTTCCTGG + Intergenic
946422914 2:219575050-219575072 ACCAGGAAGGGCGTGGCCTCAGG - Exonic
947052523 2:226062434-226062456 TCTAGGAGGGGCCAGTCTTCTGG + Intergenic
947828214 2:233120681-233120703 TCTTGCCAGGCCCTGCCCTCAGG - Intronic
948382095 2:237557915-237557937 GCCAGGAACTGCCTGCCCTCAGG - Intergenic
1169613364 20:7409474-7409496 TTTATGAAGTGCCTGCCTTCTGG - Intergenic
1170573157 20:17643755-17643777 TATAGAAAGGGCCTGTCCACTGG + Intronic
1170702378 20:18714976-18714998 TCTAGGAAAGGCCTGTGCACTGG - Intronic
1170731848 20:18982914-18982936 TCTAGGAGGTGCCTGCCCTGGGG + Intergenic
1172599184 20:36171886-36171908 TAGAGGAAGGGCCTGGACTCAGG + Intronic
1173574901 20:44106500-44106522 TCTGGGAAGGGCATGACCTTGGG - Intergenic
1174979566 20:55378302-55378324 TATAGGAACAGTCTGCCCTCTGG - Intergenic
1175105723 20:56613385-56613407 TCTAGAAAGGGCAAGCCCTGGGG - Intergenic
1175107562 20:56626166-56626188 TCCAGTAAGGGCATGCCCTGGGG - Intergenic
1175928044 20:62480502-62480524 TCTGGGAAGGGCCCTCCCTGGGG - Intergenic
1176116146 20:63432538-63432560 TCTGGGAAGGCCCCACCCTCAGG + Intronic
1176116178 20:63432628-63432650 TCTGGGAAGGCCCCACCCTCAGG + Intronic
1176116206 20:63432700-63432722 TCTGGGAAGGCCCCACCCTCAGG + Intronic
1176428187 21:6561375-6561397 GCTAGGAACGCCCTGCTCTCTGG - Intergenic
1179584859 21:42367995-42368017 TCCAGGAGGGGCCTGACCGCAGG + Intergenic
1179703678 21:43169692-43169714 GCTAGGAACGCCCTGCTCTCTGG - Intronic
1181755875 22:25024367-25024389 TGTAGCAGGTGCCTGCCCTCGGG + Intronic
1182356335 22:29723833-29723855 TCCAGCCAGTGCCTGCCCTCTGG + Intronic
1183471087 22:38007154-38007176 TCTGGGAGGGCCCTTCCCTCAGG - Intronic
1183521092 22:38296449-38296471 CATGGGAAGGGCCTGGCCTCAGG + Intronic
1183641402 22:39095133-39095155 TCTAGGACGGGCCTGTGCTTAGG - Intergenic
1183710570 22:39501154-39501176 TCTGGTAAGGGCCTCCCCTCTGG + Intronic
1184319213 22:43726539-43726561 TCCAGCTGGGGCCTGCCCTCAGG - Intronic
1184325557 22:43781029-43781051 TCTAGGGCGGGCCTTCTCTCAGG + Intronic
1184616260 22:45640479-45640501 GCAGGGAGGGGCCTGCCCTCAGG + Intergenic
949873108 3:8606206-8606228 TCTAGGAAGGGCCTGCTTCCTGG + Intergenic
950270813 3:11613464-11613486 TCTAGAATGGCCCTGCCCACAGG + Intronic
951347469 3:21563243-21563265 TCTGGTAAGGGCCTGCTTTCTGG - Intronic
952326258 3:32323011-32323033 TGTAGGAAAGGCCAGGCCTCAGG - Intronic
952904341 3:38129725-38129747 ACAAGCCAGGGCCTGCCCTCAGG + Intronic
953389886 3:42527861-42527883 TTGAGGCGGGGCCTGCCCTCTGG + Intronic
953546264 3:43865665-43865687 ACCAGGAAGGTCCTGCCCTGTGG + Intergenic
954329246 3:49880791-49880813 TCCTGGAAGGGCCTCCTCTCAGG - Intergenic
955069411 3:55559786-55559808 TCTAGCAAGGGCTTGACCTCAGG + Intronic
955415907 3:58690645-58690667 CTTAGGAAGGGCCTGGTCTCTGG + Intergenic
957941310 3:87007861-87007883 TCTGGTGAGGGCCTGCTCTCTGG - Intergenic
958156655 3:89763103-89763125 TCTGGCAAGGGCCTGCTATCTGG - Intergenic
958805720 3:98807475-98807497 ACTAGTGAGGGCCTGCCGTCTGG - Intronic
961379334 3:126487071-126487093 TCTTGGGGAGGCCTGCCCTCAGG + Intronic
961917671 3:130393835-130393857 CCTAGGAAGGGCATGACCTTTGG + Intronic
962160348 3:132992700-132992722 TGTAGGAAGGGACTGGCCTCAGG + Intergenic
965601060 3:170455058-170455080 GCATGGAAGGGCCTACCCTCAGG + Intronic
966820132 3:183917631-183917653 TCTGAGAGTGGCCTGCCCTCCGG - Intergenic
967062071 3:185881442-185881464 TCTAGGAATCGCCTCCCCTTGGG - Intergenic
969063703 4:4460479-4460501 TTTTAGAAGGGCCTGTCCTCAGG - Intronic
969868003 4:10087689-10087711 TCAAGGTAAGGCCTGCCCTGGGG - Exonic
971246693 4:24935633-24935655 TCTGGTAAGGGCTTGCTCTCTGG - Intronic
972593290 4:40508156-40508178 GCCAGGACGGGACTGCCCTCTGG + Intronic
975716490 4:77210219-77210241 TCCAGGAAGAGCCTGTTCTCAGG - Intronic
977406682 4:96608516-96608538 TCTGGGGAGGGCCTGCTTTCTGG + Intergenic
978585201 4:110269430-110269452 TCATGGAAGGGACTGCACTCAGG + Intergenic
981190066 4:141852085-141852107 TCTATTAAGGGCCTGCTTTCTGG + Intergenic
981404345 4:144350272-144350294 TCTAGTGAGGGCCTGCTTTCTGG - Intergenic
982882316 4:160734848-160734870 TCTAGTGAGGGCCTGCCACCTGG - Intergenic
985671560 5:1209434-1209456 TCCAGGAAGCACCTGCCCTTCGG + Intronic
997283442 5:132662584-132662606 CCTCGGGAGGGCCTCCCCTCTGG + Intergenic
997773763 5:136579276-136579298 GCTAGGATGGGCCCGCCCTCAGG + Intergenic
998806356 5:145920932-145920954 TCTGGTGAGGGCCTGCTCTCTGG - Intergenic
999179463 5:149658908-149658930 TCTAGGAAGAGCCTGCCTGAAGG - Intergenic
1000238603 5:159387503-159387525 TCTGGGCTGTGCCTGCCCTCAGG - Intergenic
1000415221 5:160977192-160977214 CCTAAGAAGGGCATGCCCTTGGG + Intergenic
1002613975 5:180438943-180438965 TCTGGCAAGGGCCTGCTTTCTGG - Intergenic
1003785016 6:9475757-9475779 TCTGGGTAGGGCATGACCTCAGG + Intergenic
1006654905 6:35582546-35582568 TCTGGGGAGGGCCTCTCCTCTGG - Intronic
1007682773 6:43645595-43645617 TCTCGCAAGGCCCCGCCCTCCGG - Intronic
1007828363 6:44618773-44618795 TCTGGGCAGGGGCTGTCCTCAGG + Intergenic
1009604236 6:65846453-65846475 TCTAGGATGGGCCTTCCATTTGG - Intergenic
1014774906 6:125497462-125497484 TCTGGTGAGGGCCTGCTCTCTGG - Intergenic
1015327085 6:131935362-131935384 TCTTAGCAGGGCCTACCCTCGGG - Intergenic
1015389412 6:132664351-132664373 TCTGGTAAGGGCCTGCTTTCTGG - Intergenic
1016272334 6:142302680-142302702 TCTTGGCAGGGCCAGGCCTCTGG - Intronic
1016641658 6:146356356-146356378 TCTAGGGAGGACCTGCTTTCTGG + Intronic
1018654219 6:166018572-166018594 TCTCAAAAAGGCCTGCCCTCAGG + Intergenic
1019724422 7:2593299-2593321 GCTGAGCAGGGCCTGCCCTCTGG + Intronic
1024377469 7:48655930-48655952 GTTAGGAAGGGCCTGCCCAGTGG + Intergenic
1024596864 7:50945860-50945882 TGTAGACAGGGGCTGCCCTCAGG + Intergenic
1025018664 7:55463799-55463821 GCCAGGGCGGGCCTGCCCTCAGG + Intronic
1025963819 7:66248971-66248993 TCTAGTAAGGGCCTGCTGTCTGG + Intronic
1026232306 7:68496006-68496028 TCCAGGAAGTGCCTGCCTTGGGG + Intergenic
1026362802 7:69618258-69618280 TCTAGGTAGGGCCTAGCCTTGGG + Intronic
1026766292 7:73161974-73161996 TCAAGGTGGGGCCTGCCATCCGG + Intergenic
1027042765 7:74971670-74971692 TCAAGGTGGGGCCTGCCATCCGG + Intronic
1027080877 7:75230687-75230709 TCAAGGTGGGGCCTGCCATCCGG - Intergenic
1028622505 7:92840494-92840516 TCTATGAATGGCCTGGCATCAGG + Intergenic
1032910944 7:136429330-136429352 TCTAGTAAGGGCTTGCTCTCTGG - Intergenic
1035569044 8:660093-660115 TCGGGGAAGGCCCTGCCTTCGGG - Intronic
1035569067 8:660154-660176 TCGGGGAAGGCCCTGCCTTCGGG - Intronic
1036168046 8:6456348-6456370 TCTAGGAAGGGCCCCACCCCTGG - Intronic
1036682306 8:10884393-10884415 TCTAGGAAGGTCCAGCTCACAGG + Intergenic
1039729350 8:40257435-40257457 TCTAGGAAAGGCCAGCCCACTGG + Intergenic
1039797950 8:40931496-40931518 TCTGGTGAGGGCCTGCCTTCGGG + Intergenic
1039878635 8:41609239-41609261 TCAAGGAAGGGGCTGCTCTGGGG + Intronic
1040889728 8:52304774-52304796 TCTGGGAAGGGCCTACTCCCTGG + Intronic
1041098490 8:54373344-54373366 TCTCAGCAGGGCCTGGCCTCCGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044173000 8:89080399-89080421 CCAAGGCAGGGCCTGCCCTAAGG + Intergenic
1044216684 8:89620187-89620209 TCTAGAAAGGGTCTGCTTTCCGG + Intergenic
1047179427 8:122573060-122573082 TCTATGAAGTGCCTGCCCCATGG - Intergenic
1048347207 8:133585223-133585245 TCTGGCAAGGGCCTGCTTTCTGG + Intergenic
1048469659 8:134695587-134695609 ACCAGGAAGGCGCTGCCCTCAGG + Intronic
1048927014 8:139280512-139280534 TCTGTGCAGGGCCTGCTCTCTGG + Intergenic
1049845788 8:144800382-144800404 TCTAGGGAGTGCATGTCCTCAGG - Intronic
1051356067 9:16240648-16240670 TACAGGAAGACCCTGCCCTCTGG + Intronic
1052984352 9:34475442-34475464 TCTAGGAAGCACCTGCCTTAGGG - Intronic
1056889990 9:90483011-90483033 TCTAGCGAGGGCCTGCTTTCTGG + Intergenic
1058634948 9:107029410-107029432 TCTGGGAAGGGCATGACCTTCGG - Intergenic
1058920911 9:109613883-109613905 TCTAGGCAAAACCTGCCCTCGGG - Intergenic
1060217433 9:121746726-121746748 TCCAGGAAGTGCTTCCCCTCTGG - Intronic
1062186931 9:135223228-135223250 TCAAGCCAGGGCCTGCCTTCGGG - Intergenic
1062249489 9:135587184-135587206 TTTGGGAAGGGCCTGGCCTTAGG - Intergenic
1062273335 9:135719660-135719682 GCCAGGAAGGCCCTGCCCACTGG + Intronic
1190442019 X:50484074-50484096 TCTAGGAAGGGCCCTCTTTCTGG + Intergenic
1191253222 X:58269064-58269086 TCTGGGAAGGCACTGACCTCTGG + Intergenic
1191254399 X:58273559-58273581 GCTGGGAAGGCCCTGACCTCTGG + Intergenic
1191255595 X:58278256-58278278 GCCAGGAAGGCCCTGACCTCTGG + Intergenic
1191256821 X:58283120-58283142 GCCAGGAAGGCCCTGACCTCCGG + Intergenic
1191257032 X:58283997-58284019 ACTGGGAAGGCCCTGACCTCCGG + Intergenic
1191257606 X:58286391-58286413 TCCAGGAAGGCACTGACCTCTGG + Intergenic
1193065311 X:77253575-77253597 ACAAGGAAGTGCCTGCCCTTGGG + Intergenic
1194323470 X:92480958-92480980 TCTAGGATGGGGATCCCCTCTGG + Intronic
1196410414 X:115412499-115412521 TCTGGAGAGGGCCTGCCCTCTGG + Intergenic
1197136918 X:123071967-123071989 TCTGGTGAGGGCCTGCCTTCTGG - Intergenic
1198967611 X:142244377-142244399 ACTAGGAAGGGCCTGGAATCTGG - Intergenic
1199424885 X:147689717-147689739 TCTGGTAGGGGCCTGCTCTCTGG - Intergenic
1199590221 X:149460856-149460878 TCCAGTGAGGGCCTGCCTTCAGG - Intergenic
1199679736 X:150216308-150216330 TCTAGTGAGGGCCTCCCCTTTGG - Intergenic
1199695495 X:150340741-150340763 TCTAGTGAGGGCCTCCCCTTTGG + Intergenic
1199851817 X:151729251-151729273 TCTAGGAGGAGCCTCCCCTGGGG + Intergenic
1200631571 Y:5594124-5594146 TCTAGGATGGGGATCCCCTCTGG + Intronic