ID: 1128385825

View in Genome Browser
Species Human (GRCh38)
Location 15:67147518-67147540
Sequence CAGTTTCCTCACGTGTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1398
Summary {0: 1, 1: 9, 2: 27, 3: 169, 4: 1192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128385814_1128385825 7 Left 1128385814 15:67147488-67147510 CCTGGGTAAATGCCATCCTTTCC 0: 1
1: 0
2: 1
3: 18
4: 170
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192
1128385817_1128385825 -5 Left 1128385817 15:67147500-67147522 CCATCCTTTCCTGGGCCCCAGTT 0: 1
1: 0
2: 6
3: 81
4: 604
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192
1128385818_1128385825 -9 Left 1128385818 15:67147504-67147526 CCTTTCCTGGGCCCCAGTTTCCT 0: 1
1: 5
2: 68
3: 448
4: 1894
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192
1128385813_1128385825 8 Left 1128385813 15:67147487-67147509 CCCTGGGTAAATGCCATCCTTTC 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128385825 Original CRISPR CAGTTTCCTCACGTGTTCAG GGG Intronic
900387654 1:2417861-2417883 CAGCTTCCTCACCTGTCAAGTGG + Intergenic
900388327 1:2420610-2420632 CAGTTTCCTCATCTGTAAAGCGG - Intergenic
900416793 1:2539051-2539073 CAGTTTCCTCATCTGTACAATGG - Intergenic
900417403 1:2541306-2541328 CAGTTTCCTCATCTGTTAAATGG + Intergenic
900608629 1:3535074-3535096 CAGTTTCCTCATCTGTGCATGGG + Intronic
900665328 1:3811220-3811242 CAGTTTCCTCACCTGTAAAATGG - Intergenic
900749814 1:4388250-4388272 CAGTTTTCTCATCTGTACAGTGG + Intergenic
900793073 1:4692167-4692189 AAGTTTCCTCACCTATTAAGCGG - Intronic
900888651 1:5433098-5433120 CAGTTTCCTCATCTTTTCAAAGG - Intergenic
901148963 1:7087682-7087704 CAGTTTCCACACCTGTAAAGTGG + Intronic
901234374 1:7659895-7659917 CAGTTTCCTCACTTGTAAAGTGG - Intronic
901433772 1:9234271-9234293 CAGTTTCTTCATCTGTACAGTGG - Intergenic
901527288 1:9831644-9831666 CAGTTTCCTCACCTGTAAAATGG + Intergenic
901533912 1:9870531-9870553 CAGTTTCCTTGCCTGTTAAGTGG + Intronic
901570370 1:10155381-10155403 CAGTTTCCTCATTTGTAAAGTGG - Intronic
901807890 1:11749454-11749476 CAGTTTCCTCATCTGTCCAATGG - Intronic
902080437 1:13816821-13816843 CAGTTTCCACATGTGTACAGTGG + Intronic
902195923 1:14798014-14798036 CAGTTTCCTCATCTGTAAAGTGG - Intronic
902235913 1:15057270-15057292 CAGTTTCCTCATGTGTAAAAGGG + Intronic
902293714 1:15451758-15451780 CAGTTTCCTCATCTGTAAAGAGG - Intergenic
902321394 1:15669653-15669675 GAGTTTCCTCACCTGTTAAATGG + Intergenic
902394651 1:16126036-16126058 CAGTTTCCTCCCGTGTAAAATGG + Intronic
902461165 1:16578130-16578152 CTGTTTCCTCACCTGTTCAGAGG - Intronic
902461947 1:16584411-16584433 CAGTTTCCTCACCTGTTCAGAGG - Intronic
902462726 1:16590776-16590798 CAGTTTCCTCATCTGTTCAGAGG - Intronic
902519931 1:17010504-17010526 CAGTTTCCCCAGGTGTACAATGG - Intronic
902530699 1:17088969-17088991 CAGTTTACTCATCTGTTAAGTGG + Intronic
902569066 1:17335344-17335366 CAGTTTCCTCACCTGTAAAATGG - Intronic
902614738 1:17617724-17617746 CAGTTTCCTCATCCGTACAGTGG + Intronic
902617280 1:17630685-17630707 CAGTTTCCTCACCTGGGCAATGG + Intronic
902641075 1:17766649-17766671 CAGTTTCCTCATCTGTAAAGTGG - Intronic
902699809 1:18164145-18164167 CAGTTTCCTCATCTGTACAAGGG - Intronic
902712625 1:18250679-18250701 CAGTTTCCTCTTGTGCTAAGTGG + Intronic
902805205 1:18857039-18857061 CAGTTTCCTCACCTGTAAAGTGG - Intronic
902809015 1:18877799-18877821 CAGTTTCCTCATCTGTGGAGTGG - Intronic
902838989 1:19063566-19063588 CAGTTTCCTCACCTGGAGAGTGG + Intergenic
903158831 1:21469905-21469927 CAGTTTCCTCATCTGTACATAGG + Intronic
903178602 1:21594522-21594544 CAGTTTCCTCATCTGTGCAGTGG - Intergenic
903193098 1:21667773-21667795 CAGTTTCCTCACCTGTGCAATGG + Intronic
903264291 1:22147718-22147740 CAGTTTCCTCATCTGTTCAAGGG + Intergenic
903277273 1:22230212-22230234 CAGTTTCCTCACCTGTAAAATGG - Intergenic
903286067 1:22277486-22277508 CAGTTTCCTCATCTGTTAAATGG + Intergenic
903306705 1:22417994-22418016 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
903321408 1:22545540-22545562 CAGTTTCCCCGCCTGTGCAGTGG + Intergenic
903338487 1:22640130-22640152 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
903360295 1:22772757-22772779 CAGTTTCCTCATCTGTACAGTGG + Intronic
903372142 1:22843220-22843242 CAGTTTCCTCAGGTGTAAAATGG - Intronic
903475077 1:23613912-23613934 CAGTTTTCTCATCTGTTAAGTGG - Intronic
903536934 1:24073145-24073167 CAGTTTCCTCACCCGTAAAGAGG - Intronic
903557630 1:24205105-24205127 CAGTTTCCTCTTGTGTACAAAGG - Intergenic
903589366 1:24442447-24442469 CAGTTTCCTCATCTGTTAAATGG - Intronic
903670567 1:25033164-25033186 CAGTTTCCTCACCTGTAGAATGG - Intergenic
903737311 1:25538263-25538285 CAGTTTCCTCATCTGTATAGTGG - Intergenic
903773165 1:25776927-25776949 CAGTTTCCTAACGTGTAAACTGG - Intronic
903809636 1:26028300-26028322 CAGTTTCCCCATCTGTTCAATGG + Intronic
903890607 1:26567850-26567872 CAGTTTCCTCACTTGTAAAATGG - Intronic
904040895 1:27584411-27584433 CAGTTTCCTCACCTGTTGAGGGG - Intronic
904306022 1:29590844-29590866 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
904330995 1:29757719-29757741 CAGTTTCCTCATCTGCTCAGTGG + Intergenic
904342257 1:29844331-29844353 CAGTTTCCTCATCTGTACAGTGG + Intergenic
904378300 1:30095342-30095364 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
904399959 1:30249625-30249647 CAGTTTCCTCATGTGTACAGTGG - Intergenic
904405484 1:30285660-30285682 CAGTTTCCTCACCTGTGCAATGG - Intergenic
904417750 1:30373473-30373495 CAGTCTCCTCCCGTGTTAAATGG + Intergenic
904433238 1:30478709-30478731 CAGTTTCCTCATCTGTACAATGG + Intergenic
904448893 1:30598461-30598483 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
904490512 1:30856093-30856115 CAGTTTTCTCACCTGTAAAGTGG + Intergenic
904492059 1:30867220-30867242 CAGTTTCCTCACTTGTAAAATGG - Intergenic
904539430 1:31222853-31222875 CAGTTTCCTCATCTGTACATGGG + Intronic
904621775 1:31779720-31779742 CAGTTTCCTCCTGTGTCAAGTGG - Intergenic
904716658 1:32473053-32473075 CAATTACCTCACCTGTTAAGAGG - Intronic
904819251 1:33230179-33230201 CAGTTTCCTCACTTGTAAACTGG + Intergenic
904900860 1:33856042-33856064 CAGTTTCCTCATCTGTGCAATGG + Intronic
904912797 1:33947876-33947898 CAGTTTCCTCTCCTGTCCAATGG - Intronic
905035633 1:34916508-34916530 CAGTTTCCTCACCTGTAAAATGG - Intronic
905047424 1:35017058-35017080 CAGTTTCCTCATCTGTAAAGTGG - Intronic
905271526 1:36790746-36790768 CAGTTTACTCACCTGTGCATTGG - Intergenic
905281853 1:36854289-36854311 CAGTTTCCTCATCTGTGCAATGG + Intronic
905314464 1:37072997-37073019 CAGTTTCCTCATCTGTTAAATGG - Intergenic
905351300 1:37348301-37348323 CAGTTTCCTCACCTGTAAAATGG - Intergenic
905462597 1:38131480-38131502 CAGTTTCCTCACCTGTAAAATGG - Intergenic
905528980 1:38661504-38661526 CAGTTTCCTCACCTGTAAAATGG - Intergenic
905903444 1:41597543-41597565 CAGTTTCCTCACCTGTAAAATGG - Intronic
905945721 1:41900206-41900228 CAGTTTCCTCACCTTTAAAGTGG + Intronic
905970732 1:42140399-42140421 CAGTTTCCTCACCTGTAAAATGG - Intergenic
906208617 1:44000094-44000116 CAGTTTCCTCATCTGTAAAGTGG + Intronic
906245617 1:44271578-44271600 CAGTTTCCTCACCTGTACAATGG + Intronic
906696111 1:47824490-47824512 CAGTTTCCTCATCTGTGAAGTGG - Intronic
906707797 1:47907481-47907503 CAGTTTCCTCATCTATTAAGTGG - Intronic
906932196 1:50181037-50181059 CAGTTTCCTCACCTGTATAAAGG - Intronic
907142801 1:52204285-52204307 CAGTTTTCTCCCCTGTTTAGAGG + Intronic
907184852 1:52602007-52602029 CAGTTTCTCCACATGTTAAGTGG - Intergenic
907316236 1:53574518-53574540 CTGTTTCCTCACCTGTACAATGG - Intronic
907317192 1:53579970-53579992 CAGTTTACTTACCTGTTCAGTGG - Intronic
907334813 1:53693208-53693230 CAGTTTCCTCATCTGTAAAGTGG - Intronic
907401850 1:54229236-54229258 CTGTTTCCTCACCTGTGAAGTGG - Intronic
907514642 1:54985949-54985971 CAGTTTCCTCATCTGTGAAGTGG - Intronic
907517970 1:55005292-55005314 CAGTTTCCTCATCTGTACAATGG - Intronic
907798074 1:57737451-57737473 CAGTTTCCTCATCTGTTAAATGG + Intronic
907837106 1:58120474-58120496 CAGTTTCCACACCTGTACATGGG + Intronic
908577804 1:65479406-65479428 CGGTTTCCTCACCTGTACAAAGG - Intronic
908789605 1:67768665-67768687 CAGTTTCCTCATCTGTTAAATGG - Intronic
909529815 1:76669872-76669894 CAGTTTCCTCATTTGTGAAGTGG - Intergenic
911183574 1:94882179-94882201 CAGTTTCCTCATTTGTACAATGG - Intronic
911662244 1:100514671-100514693 CAGTTTCCTCATCTGTAAAGTGG + Intronic
911934637 1:103953175-103953197 CAGTTTCATCATGTGGTCAAGGG - Intergenic
912713084 1:111963454-111963476 CAGTTTTCTCACCTGTAAAGTGG + Intronic
912787122 1:112615427-112615449 CAGTTTCCTCATCTGTTAACTGG - Intronic
912838111 1:113014708-113014730 CAGTTTCCTCATCTGTACAATGG - Intergenic
913114785 1:115685904-115685926 CAGTTTCCTAACCTGTTAATTGG + Intronic
913216411 1:116624386-116624408 CAGTTTCCTCATCTGTAAAGTGG + Intronic
913254006 1:116937939-116937961 CAGTTTCCTCACGTGTGAAATGG - Intronic
913381767 1:118218666-118218688 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
913515700 1:119603791-119603813 CAGTTTCCTCACCAGTAAAGTGG + Intergenic
913543406 1:119843250-119843272 CGGTTTCCTCATCTGTTCAGAGG - Intergenic
913568641 1:120098571-120098593 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
913602750 1:120437747-120437769 CAGTTTCCTCATCTGTTCAGAGG + Intergenic
913603498 1:120444100-120444122 CAGTTTCCTCATCTGTTCAGAGG + Intergenic
913604257 1:120450443-120450465 CAGTTTCCTCACCTGTTCAGAGG + Intergenic
913640352 1:120806814-120806836 CAGTTTCCTCATCTGTTCAGAGG + Intronic
913641129 1:120813154-120813176 CAGTTTCCTCACCTGTTCAGAGG + Intronic
913990830 1:143610151-143610173 CAGTTTCCTCATCTGTTCACAGG - Intergenic
914044740 1:144081754-144081776 CAGTTTCCTCATGTGTGAAATGG - Intergenic
914084286 1:144438762-144438784 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914133370 1:144878932-144878954 CAGTTTCCTCATGTGTGAAATGG + Intergenic
914190305 1:145404033-145404055 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914212161 1:145589815-145589837 CAGTTTCCTCATCTGTTCAGAGG - Intergenic
914277354 1:146137170-146137192 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914278124 1:146143527-146143549 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914289455 1:146259592-146259614 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914363924 1:146961367-146961389 CAGTTTCCTCATCTGTTCAGAGG + Intronic
914364687 1:146967712-146967734 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914365453 1:146973999-146974021 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914381786 1:147123023-147123045 TAGTTTCCTCATCTGTTCATGGG - Intergenic
914444427 1:147737943-147737965 CAGTTTCTTCATTTGTTTAGTGG - Intergenic
914486992 1:148119440-148119462 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914487753 1:148125776-148125798 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914538402 1:148588118-148588140 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914539170 1:148594475-148594497 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914550491 1:148710345-148710367 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914587328 1:149074585-149074607 CAGTTACCTCACCTGTTCAGAGG - Intronic
914588108 1:149080898-149080920 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914627508 1:149477153-149477175 CAGTTTCCTCATCTGTTCAGAGG + Intergenic
914943187 1:152040679-152040701 CAGTTTCCTCATCTGTAAAGTGG + Intronic
915246533 1:154559343-154559365 CAGTTTCCTCATCTGTACAATGG + Intergenic
915509912 1:156381224-156381246 CAGTTTCCTCATATGTTCAGTGG - Intronic
915534473 1:156526736-156526758 CAGTTTCCTCATTTGTGAAGTGG - Intronic
915671102 1:157489772-157489794 CAGTTTCCTCATGTGTAAAATGG + Intergenic
915823256 1:159048336-159048358 CAGTTTTCTCACATGTGAAGTGG - Intronic
916057823 1:161080135-161080157 CAGTTTCCTCATCTGTTAAACGG - Intronic
916411079 1:164547881-164547903 TAGTTTCCTCACGTGTAAAATGG + Intergenic
916529506 1:165642718-165642740 CAGTTTCCTCACTTGTTAAATGG - Intronic
916819129 1:168381145-168381167 CAGTTTCCTCACCTGTTAAATGG - Intergenic
916997609 1:170317370-170317392 CAGTTTCCTCATATGTAAAGAGG - Intergenic
917231994 1:172847222-172847244 CAGTTTCCTCATTTGTTAAAGGG - Intergenic
917399234 1:174628565-174628587 CAGTTTCCTCATGTGTAAAATGG - Intronic
917976938 1:180245752-180245774 CAGTTTCCTCACCTGTAAAAGGG - Intronic
918149557 1:181786345-181786367 CAGTTTCTTCATGTGTAAAGTGG - Intronic
918243170 1:182637643-182637665 CGGTTTCCTCACCTGTACATGGG + Intergenic
918453669 1:184685413-184685435 CAGTTTCCTCATCTGTGAAGCGG - Intergenic
919016637 1:192046714-192046736 CAGTTTCCTCACTTATAAAGTGG + Intergenic
919647919 1:200114563-200114585 CAGTGTCCTCACCTGTCCAGTGG + Intronic
919772545 1:201171660-201171682 CAGTTTTCTCACCTGCGCAGTGG + Intergenic
919878291 1:201886379-201886401 CAGTTTCCTCATCTGTACAATGG + Intergenic
920185056 1:204154319-204154341 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
920883278 1:209899873-209899895 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
920939892 1:210472303-210472325 CAGTTTCATCACCTGTAGAGTGG - Intronic
921168861 1:212527736-212527758 CAGTTTCCTCACCTATACAGTGG - Intergenic
921255629 1:213336675-213336697 CAGTTTCCTCACCTGTAAAATGG - Intergenic
921261045 1:213385326-213385348 CAGTTTCCTCACCTGTAGAATGG - Intergenic
921480407 1:215658440-215658462 CAGTTTTCTCATGTGTAAAGTGG - Intronic
921551235 1:216537770-216537792 CAGTTTCCTCAAATGTAAAGTGG - Intronic
921767729 1:218992077-218992099 CAGTTTCCTCACTTGTAAACTGG + Intergenic
922041176 1:221900312-221900334 CAGTTCCCTCATGTGTCCAGTGG + Intergenic
922066886 1:222152803-222152825 CAGTTTCCTCCTGTGTGCAATGG - Intergenic
922446702 1:225703828-225703850 CAGTTTCCTCATGTGTAAATGGG + Intergenic
923008597 1:230070986-230071008 CAGTTTCCTCATCTTTGCAGTGG + Intronic
923260883 1:232267000-232267022 CAGTTTCCTCAGCTGTAAAGTGG - Intergenic
923618304 1:235556206-235556228 CAGTTTCCTCATCTGTAAAGTGG - Intronic
923743505 1:236678095-236678117 CAGTTTCCTCATGTGTAATGGGG + Intergenic
923802579 1:237224894-237224916 CAGTTTCCTCACCTGTAAAGTGG - Intronic
924171625 1:241348153-241348175 CAGTTACCTCACGTGGCTAGTGG + Intronic
1062970297 10:1643065-1643087 CAGTTTCCCCAGGTGTAAAGTGG - Intronic
1063265869 10:4450063-4450085 CAGTTTCCTCACCTCTAAAGTGG + Intergenic
1063465996 10:6245002-6245024 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1064020994 10:11808986-11809008 CAGTTTCCTCATCTGTGCAATGG + Intergenic
1064133813 10:12732924-12732946 CAGTTTCCTCATCTGTTGAATGG + Intronic
1065115791 10:22481268-22481290 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1065208327 10:23378339-23378361 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1065211803 10:23411061-23411083 CAGTTTCTTCACCTGTAAAGTGG + Intergenic
1066956865 10:42181434-42181456 CAGTTTCCTCATGTGTGAAATGG - Intergenic
1067072373 10:43143049-43143071 CAGTTTCCTCCTCTGTTAAGTGG - Intronic
1067569036 10:47358399-47358421 CAGTTTGTTCACCTGTTCAATGG + Intergenic
1067676971 10:48389634-48389656 CAGTTTGTTCACTTGTTCATTGG + Intronic
1067683179 10:48452741-48452763 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1067844259 10:49707208-49707230 CAGTTTCCCCACCTGTTAAATGG - Intronic
1068780437 10:60913845-60913867 CAGTCTCCTCATCTGTTAAGTGG + Intronic
1068865341 10:61889325-61889347 CAGTTTCCTCATGTGTAATGAGG + Intergenic
1069551274 10:69366209-69366231 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1069609765 10:69765181-69765203 CAGTTTCCTCAACTGTAAAGTGG + Intergenic
1069704530 10:70449859-70449881 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1069823837 10:71243306-71243328 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1069827541 10:71263289-71263311 CAGTTTCCTCATCTGTCCAAAGG + Intronic
1069843958 10:71357859-71357881 CAGTTTCCTCACCTGTTAAATGG - Intronic
1069948462 10:72003083-72003105 CAGTTTCCTCACCTGTAAAATGG + Intronic
1070092117 10:73297598-73297620 CAGCTTCCTCATTTGTTAAGAGG + Intronic
1070343875 10:75523067-75523089 CAGTTTCCTCACTTGTAAATGGG + Intronic
1070379090 10:75863569-75863591 CAGTTTCCTCACCTGTAAAATGG + Intronic
1070495510 10:77017820-77017842 CAGTTTCCTCATATGTAAAGTGG + Intronic
1070571575 10:77643317-77643339 CAGTTTTCTCACCTGTAAAGTGG - Intergenic
1070724900 10:78781191-78781213 CAGTTTCCTCATCTATGCAGGGG - Intergenic
1070750170 10:78959441-78959463 CACTTTCCTCATCTGTACAGTGG - Intergenic
1070773821 10:79098440-79098462 CAGTTTCCTCACCTGTAAAATGG + Intronic
1070796009 10:79216615-79216637 CAGTTTCCTCATGTGTAAAATGG - Intronic
1071255605 10:83869260-83869282 CAGTTTCCCCACTTGTTATGTGG + Intergenic
1071507863 10:86243511-86243533 CAGTTTCCTCATCTGTTAAGTGG - Intronic
1071682136 10:87716964-87716986 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1071808782 10:89155193-89155215 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1071986727 10:91059125-91059147 CAGTTTCTTCACCTGTGAAGTGG + Intergenic
1072301774 10:94068710-94068732 CAGTTTCCTCACCTGTAAAATGG - Intronic
1072313528 10:94180021-94180043 CAGTTTTCTCACCTGTTAAGTGG - Intronic
1072446191 10:95500840-95500862 CAGTTTCCTCCCCTGTACACAGG + Intronic
1072537445 10:96374297-96374319 CATTTTCCTCACCTGTAAAGCGG - Intronic
1072725631 10:97811546-97811568 CAGTTTCCTCATCTGTCAAGTGG + Intergenic
1072745281 10:97935216-97935238 CAGTTTCCTCAATTGTACAGTGG + Intronic
1072832875 10:98677585-98677607 CAGTTTCCCCATCTGTTAAGTGG - Intronic
1073187080 10:101621703-101621725 CAGTTTCCTCATTTGTAAAGTGG - Intronic
1073461732 10:103669344-103669366 CAGTTTCCTCACCTGTGAAATGG + Intronic
1073573199 10:104598373-104598395 TAGTTTCCTCTCTTGTTTAGAGG + Intergenic
1073584277 10:104693676-104693698 CAGTTTCCTCAATTGTTAAATGG - Intronic
1073635147 10:105190296-105190318 CAGTTTCCTCATCTGTTAAATGG + Intronic
1073635971 10:105199556-105199578 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1073641934 10:105261799-105261821 TAGTTTCCTCATCTGTTCAATGG - Intronic
1074046367 10:109843263-109843285 CTGTTTCCTGACGTATTCATTGG - Intergenic
1074080572 10:110165213-110165235 CTGTTTTCTCATCTGTTCAGTGG + Intergenic
1074164355 10:110861675-110861697 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1074420481 10:113304544-113304566 CAGTTTCCTCAACTGTCCAATGG + Intergenic
1074432194 10:113403740-113403762 CAGTTTCCTCATCTGTTAAATGG - Intergenic
1074443462 10:113498706-113498728 CAGTTTCCTCATCTGTTCAATGG + Intergenic
1074967627 10:118506430-118506452 CAGTTTCTTCACGTGTAAAATGG - Intergenic
1075385732 10:122054022-122054044 CAGTTTCCTCATCTGTAGAGTGG - Intronic
1075418919 10:122286398-122286420 CAGTTTCCTCAAGTGTAAAATGG + Intronic
1075444732 10:122505524-122505546 CAGTTTCCTCATCTGTTAAATGG + Intronic
1075590251 10:123685848-123685870 CAATTTCCTCACCTGTAAAGTGG + Intronic
1075619062 10:123912368-123912390 CACTTTTCTCACCTGTTCAGTGG - Intronic
1075669554 10:124254983-124255005 CAGTCTCCTCATCTGTGCAGTGG + Intergenic
1075849354 10:125574569-125574591 CCGTTTCCTCACCTGTACAATGG - Intergenic
1076075607 10:127531541-127531563 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1076889565 10:133277017-133277039 GAGTTTCCTCACCTGTGCAAGGG - Intergenic
1076915804 10:133422793-133422815 CAGATTCCTCAGGGGCTCAGTGG + Exonic
1077299551 11:1840713-1840735 CAGTTTCCCCACTTGTCAAGAGG + Intronic
1077716763 11:4589055-4589077 CTGTTTCTTCAAGTTTTCAGAGG - Intergenic
1078065035 11:8072703-8072725 CAGTTTCCTCATCTGTTGATTGG - Intronic
1078436783 11:11332048-11332070 CAGTTTCTTCACCTGTTAAATGG - Intronic
1078529909 11:12129385-12129407 CAGTCTCCTGACCTGTTCAATGG - Intronic
1078536699 11:12180659-12180681 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1078563453 11:12393315-12393337 CAGTTTCCTCATCTGTAAAGGGG - Intronic
1078853773 11:15189544-15189566 CAGTTTCCTCATCTATACAGTGG - Intronic
1078893191 11:15576035-15576057 CAGTTTCCTCCTGTGTTAAATGG + Intergenic
1079098117 11:17524094-17524116 CAGTTTCCTCATATGTAAAGTGG + Intronic
1079245629 11:18750253-18750275 CAGTTTCCTCATGTGTAAAATGG - Intronic
1079417211 11:20250149-20250171 CAGTTTCCTCATCTATTCATTGG + Intergenic
1079490380 11:20982511-20982533 TAGTTGCCTCACCTGTTCAATGG + Intronic
1079631108 11:22676538-22676560 CATTTTCCTCATCTGTACAGTGG + Intronic
1079997532 11:27310500-27310522 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1080278730 11:30532041-30532063 CAGTTTCCTCACACGTTAAAAGG + Intronic
1080299794 11:30771232-30771254 CAGTTTCCTCATCTGTACAAGGG + Intergenic
1080433943 11:32222802-32222824 CAGTTTCCTCATTTGTTTAAAGG - Intergenic
1080456037 11:32420332-32420354 CAGTTTTCTCATCTGTTCAATGG + Intronic
1080617505 11:33957496-33957518 CAGTTTCCTCATCTGTGCAATGG + Intergenic
1080653531 11:34241183-34241205 CAGTTTCCTCATCTGTACAGCGG + Intronic
1080683519 11:34496784-34496806 CAATCTCCTCACGTGTAAAGTGG - Intronic
1080753651 11:35174501-35174523 CAGTTTCCTCAAGTGTAAACCGG + Intronic
1081121024 11:39266453-39266475 CAGTTTCCTCACTTGTGAAATGG - Intergenic
1081325268 11:41737005-41737027 CAGTTTCCACACATGGTGAGAGG - Intergenic
1081494163 11:43589891-43589913 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1081495659 11:43607612-43607634 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1081516124 11:43831950-43831972 CAGTTTCCTCATCTGTACAATGG - Intronic
1081611682 11:44566613-44566635 CAGTTTCCTCACCTGTAAAATGG + Intronic
1081613296 11:44576349-44576371 CAGTTTCCTCATCTGTACAATGG - Intronic
1081672030 11:44947781-44947803 CAGTTTCCTCATCTGTTAAATGG + Intronic
1081691627 11:45082238-45082260 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1081694071 11:45097482-45097504 CAATTTCCTCACCTGTTAAATGG - Intronic
1081962513 11:47148798-47148820 CAGTTTCCTCATCTGTGAAGAGG - Intronic
1082800143 11:57408728-57408750 GAGGTTACTTACGTGTTCAGAGG - Intronic
1083174871 11:60943356-60943378 CTGTTTCCTCATGTGTACAATGG - Intronic
1083276532 11:61600058-61600080 CAGTTTCCCCATCTGTTAAGTGG + Intergenic
1083462635 11:62824703-62824725 CAGTTTCCTCACCTGTAAAATGG + Intronic
1083582404 11:63833221-63833243 CAGTTTCCTCACCTGTATAATGG - Intergenic
1083620305 11:64046056-64046078 CAGTTTCCTCATGTGTAAAAAGG - Intronic
1083628299 11:64083060-64083082 CAGTTTCCTCACCTGTGAAATGG - Intronic
1083742802 11:64720093-64720115 CAGTTTCCTCACGTGTGAAATGG - Intronic
1083777826 11:64902833-64902855 CAGTTTGTTCATCTGTTCAGTGG - Intronic
1083889257 11:65587837-65587859 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1083943391 11:65910783-65910805 CAGTTCCCTCACTTGTAAAGAGG + Intergenic
1084006377 11:66325669-66325691 CAGGTTCCTCACCTGTGCAAGGG + Intergenic
1084025743 11:66447987-66448009 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1084033552 11:66494689-66494711 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084121222 11:67070179-67070201 CAGTTACCGCACCTGTACAGTGG + Intronic
1084270686 11:68027631-68027653 CAGTTTCCCCATCTGTCCAGTGG - Intronic
1084460997 11:69296476-69296498 CAGTTTCCTCATCTGTTAAGTGG - Exonic
1084469937 11:69353645-69353667 CAGTTTCCTCATCTGTGAAGGGG + Intronic
1084518663 11:69649895-69649917 CAGTTTCCCCATCTGTACAGTGG + Intronic
1084573502 11:69974459-69974481 CAGTTTCCTCATCTGTAAAGCGG - Intergenic
1084899666 11:72300207-72300229 CAGTTTCCACATCTGTTCAATGG + Intronic
1085045438 11:73350022-73350044 CAGTTTCCTCATCTGTAGAGAGG + Intronic
1085048137 11:73365098-73365120 CAGCTTCCCCACCTGTCCAGGGG + Intronic
1085083663 11:73652723-73652745 CAGTTTCCTCATCTATACAGTGG - Intronic
1085231753 11:74977996-74978018 CAGTTTCCTCATGTGTAAAATGG - Exonic
1085395074 11:76203084-76203106 CAGTTTCCCCACTTGCACAGTGG - Intronic
1085450109 11:76626790-76626812 CAGTCTCCTCATGAGTCCAGTGG + Intergenic
1085611368 11:77953462-77953484 CAGTTTCCTCATCTGTTAAGTGG - Intronic
1085653718 11:78292889-78292911 CTTTTTCCTCACCTGTTAAGAGG - Intronic
1085734560 11:79028126-79028148 CAGTTTCCTCACTTGTGAAGTGG + Intronic
1086177182 11:83905218-83905240 CAGTTTCCTCACCTACTAAGTGG - Intronic
1086180867 11:83950087-83950109 CAGTTACCTCACGTGTAAAAGGG + Intronic
1086181822 11:83961205-83961227 CAGTTTTCTCACCTGTACAAGGG - Intronic
1086192135 11:84092414-84092436 CAGTTTCCTCACTGGTACATTGG - Intronic
1086208330 11:84287002-84287024 CAGTTTCCTCATATGTAAAGTGG + Intronic
1086368220 11:86130088-86130110 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1087163625 11:94975464-94975486 CAGTTTCCTCACGTGTAAAATGG + Intronic
1087810737 11:102606884-102606906 CAGCTTCCTCACTTGTTAAAAGG + Intronic
1088503450 11:110507095-110507117 CAGTTTCCTCACATGTAAAATGG - Intergenic
1088503954 11:110511150-110511172 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1088606038 11:111533306-111533328 CAGTTTCCTCACCTATACAGTGG + Intronic
1088693978 11:112350507-112350529 CAGTTTCCTAACCTGTAAAGGGG + Intergenic
1088742250 11:112776746-112776768 CAGTTTCCTCACCTGTTTGCTGG - Intergenic
1088832780 11:113551642-113551664 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1089111462 11:116061235-116061257 CAGTTTCCTCATTTGTAGAGAGG + Intergenic
1089152876 11:116377768-116377790 CAGTTTCCTCACTTGTAAAATGG - Intergenic
1089163682 11:116458600-116458622 CAGTTTCCTCATCTGTACAATGG + Intergenic
1089301782 11:117503315-117503337 CAGTTTCCTCACCTGTACGAGGG - Intronic
1089333827 11:117709016-117709038 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1089391085 11:118102360-118102382 CAGTTTCCTCATCTGTACAATGG - Intronic
1089889605 11:121867771-121867793 CAGTTTCCTCATTTGTAAAGTGG - Intergenic
1089921569 11:122213798-122213820 CAGTTTCCCCACCTGTACAATGG + Intergenic
1089988416 11:122835214-122835236 CAGTTTCCTCACTTGTAAAATGG - Intergenic
1090364088 11:126191867-126191889 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1090407909 11:126488380-126488402 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1090523626 11:127505368-127505390 CAGTTTCCTCATGTGTAAACAGG + Intergenic
1090732239 11:129581782-129581804 CAGTCTCCTCACCTCTGCAGTGG - Intergenic
1091832190 12:3557698-3557720 CAGTTTCCACACCTGTTAATGGG - Intronic
1092111211 12:5966046-5966068 CAGTGCCCTCTGGTGTTCAGAGG - Intronic
1092121416 12:6046657-6046679 CAGATTCCTCACGTGTGGAATGG - Intronic
1092153819 12:6269220-6269242 CAGTTTCTTCACCTGTGAAGTGG + Intergenic
1092154831 12:6275386-6275408 CAATTTCCTCACCTGTTAAATGG - Intergenic
1092174223 12:6391808-6391830 CAGTTTCCTCATTTGTTAAATGG - Intergenic
1092230180 12:6771870-6771892 CAGTTTCCTCATCTGTACAATGG + Intergenic
1092231737 12:6779499-6779521 CAGTTTCCTCACCTATTAAATGG + Intergenic
1092790924 12:12070335-12070357 CAGTTTCCTCATCTGTGCAATGG + Intronic
1093083851 12:14844663-14844685 CTGTTTCCTCATGTGTTGAATGG + Intronic
1093194946 12:16119782-16119804 CAGTTTCCTTATCTGTACAGTGG + Intergenic
1093865386 12:24221002-24221024 CAGTATCCTCATTTGTTAAGTGG - Intergenic
1094052481 12:26236395-26236417 CAGTTTCCTCATGTGTAAAGTGG + Intronic
1094067739 12:26379185-26379207 CAGTTTCCTCATGTGTACAATGG + Intronic
1094201891 12:27803567-27803589 CAGTTTCCTCAACTGTAAAGCGG - Intergenic
1094526955 12:31237512-31237534 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1095159286 12:38897909-38897931 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1095879191 12:47114273-47114295 CAGTTTCCTCATGTGTCAAATGG - Intronic
1096200355 12:49677441-49677463 CAGTTTCCTCACCTGTAAAATGG + Intronic
1096328309 12:50686101-50686123 CAGTTTCCTCACTTGTAAAATGG - Intronic
1097125017 12:56767189-56767211 CAGTTTCCTCATGTGAAAAGTGG + Intronic
1097971499 12:65638266-65638288 CAGTTTCTTCATGTGTCCAGCGG - Intergenic
1097985531 12:65779465-65779487 CAGTTTCCTCACCTGCTAAATGG + Intergenic
1098897425 12:76080035-76080057 CAGTTGCCTCCCCTCTTCAGTGG - Intronic
1098995793 12:77118231-77118253 CAGTTTCCTCATTTGTAAAGTGG + Intergenic
1099061007 12:77909022-77909044 CAGTTTCTTCATCTGTACAGTGG + Intronic
1100287979 12:93185572-93185594 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1100733533 12:97500581-97500603 CAGTTTCTTCAACTGTTAAGTGG - Intergenic
1100749561 12:97682137-97682159 CTGTTCCCTCACTTGTTAAGTGG + Intergenic
1100785885 12:98077400-98077422 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1100800599 12:98226557-98226579 CAGTTTTCTCACCTGTACAATGG - Intergenic
1101147277 12:101853192-101853214 CAGTTTCCTCATGTGTAAAATGG + Intergenic
1101255316 12:102971487-102971509 CAGTTTCGTCACCTGTTTAGTGG + Intergenic
1101363865 12:104053464-104053486 CAGTTTCCTCATCTGTTAAGTGG + Intronic
1101411301 12:104470724-104470746 CAGTTTCCTCACCTGTATAATGG - Intronic
1101433410 12:104645352-104645374 CAGTTTCCTCACCTGTATGGTGG - Intronic
1101442196 12:104712205-104712227 CAGTTTCCTCAGGTGTCAAATGG - Intronic
1101676348 12:106920368-106920390 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1101801235 12:108023757-108023779 CAGTTTCCTTACCTGTTAAATGG + Intergenic
1101818040 12:108160932-108160954 CAGTTTCCTCACTTATAAAGTGG + Intronic
1101822133 12:108192288-108192310 CAGGTTCCTCACCTGTAAAGTGG - Intronic
1101894556 12:108746103-108746125 CTGTTTCCTCATCTCTTCAGTGG + Intergenic
1101935728 12:109054709-109054731 CAGTTTCCTCATCTGTACAATGG - Intronic
1102041416 12:109803269-109803291 CTGTTTCCTCATCTGTCCAGTGG + Intronic
1102045398 12:109826798-109826820 CAGTTTCCTCACCTGTAAAAGGG + Intronic
1102169506 12:110831391-110831413 CAGTTTCCTCACCTGTAAAGGGG + Intergenic
1102208313 12:111105735-111105757 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1102208519 12:111107118-111107140 CAGTTTCCTCACCTGTAAAATGG - Intronic
1102259937 12:111437555-111437577 CAGTTTCCTCACCTGTAAAATGG - Intronic
1102391495 12:112552432-112552454 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1102399081 12:112613127-112613149 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1102581105 12:113888609-113888631 CAGTTTCCTCATCTGTTGAATGG - Intronic
1102717830 12:114989409-114989431 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1102772969 12:115494602-115494624 CAGTTTCCTCATCTGCTCAATGG - Intergenic
1102773079 12:115495461-115495483 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1102781017 12:115564510-115564532 CAGTTTCCTCATGTGTCAAGTGG + Intergenic
1102784364 12:115592201-115592223 CAGTTTCCACATGTGTAAAGTGG + Intergenic
1102872919 12:116427899-116427921 CAGTTTCCTCAACTGTCAAGTGG - Intergenic
1102915752 12:116750519-116750541 CAGTTTCCTCATCTGTCTAGTGG + Intronic
1102961425 12:117096001-117096023 CAGTTTCCTCACCTGTAAAATGG + Intronic
1103113565 12:118305057-118305079 CAGTTTCCTCATCTGTACAAAGG + Intronic
1103197281 12:119055783-119055805 CAGTTTCCTCACCTGTGAAATGG + Intronic
1103721217 12:122976581-122976603 CAGTTTCTTCATCTGTACAGTGG + Intronic
1103748294 12:123141250-123141272 CAGTTTCCTCACCTGTAAAATGG + Intronic
1103920088 12:124394865-124394887 CAGTTTCTTCATCTGTACAGTGG - Intronic
1103941982 12:124506195-124506217 CAGTTTTCTGATCTGTTCAGTGG - Intronic
1103946086 12:124527343-124527365 CAGTTTCCTCATATGTAAAGAGG + Intronic
1103973600 12:124687847-124687869 CAGTTTCCTCATCTGTACAATGG + Intergenic
1104070635 12:125342386-125342408 CAGTTTCCTCCTCTGTTAAGTGG + Intronic
1104414890 12:128589822-128589844 CAGTTTTCTCACCTGTAAAGTGG + Intronic
1104944323 12:132408929-132408951 CAGTTTCCTCACCTGTGACGTGG + Intergenic
1104954689 12:132458460-132458482 CAGTCTCCTCACCTGTAAAGGGG - Intergenic
1105455021 13:20532510-20532532 CAGTTGCTTCACGTCTTCACTGG - Intergenic
1105956008 13:25283330-25283352 CAGTTTCCTCACCTGTAAAATGG + Intronic
1106580765 13:31016565-31016587 CAGTGTGCTCACGTGGTGAGGGG + Intergenic
1106753529 13:32798415-32798437 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1106909447 13:34447786-34447808 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1107137744 13:36962769-36962791 CAGTATCCTCATGTGCTGAGGGG - Intronic
1107174719 13:37387092-37387114 CAGTTTCCTCAGGTATAAAGAGG - Intergenic
1107414249 13:40186731-40186753 CAGTTTCCTCACCTATTAAATGG - Intergenic
1108280017 13:48851930-48851952 CAGTTTCCTCATTTGGTAAGTGG - Intergenic
1108748834 13:53425184-53425206 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1109801839 13:67390109-67390131 CAGTTTCCTCATCTGTTAAATGG - Intergenic
1110040769 13:70755069-70755091 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1110113205 13:71777347-71777369 CAGTTTCCTCATGAGTTAAATGG + Intronic
1110461286 13:75748409-75748431 CAGTTTCCTCATGTGTGAAGTGG + Intronic
1110703027 13:78571778-78571800 CAGTTTCCTCATTTGTACAATGG + Intergenic
1110740579 13:78991310-78991332 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1110805502 13:79749722-79749744 ATGTTTCCTAACTTGTTCAGTGG - Intergenic
1111845600 13:93504823-93504845 CAGTTTCCTGAGGTTGTCAGAGG - Intronic
1111853251 13:93603521-93603543 CAGTTTCCTCACCTGCAAAGTGG - Intronic
1111962344 13:94825456-94825478 CAGTTTCCTCACCTGTAAAGGGG - Intergenic
1112072485 13:95869701-95869723 CATTTTCCTCATGTATCCAGAGG - Intronic
1112123370 13:96437521-96437543 AAGCATCCTCATGTGTTCAGTGG - Intronic
1112661842 13:101518862-101518884 CAGTTTCCTCAACTGTAAAGTGG - Intronic
1112755653 13:102630015-102630037 CAGTTTACTCAAGTGAACAGTGG + Intronic
1113119839 13:106914423-106914445 CAGTTTCCTCACTTGTGAACTGG - Intergenic
1113459032 13:110468863-110468885 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1113949870 13:114065991-114066013 CAGTCTCCCCATCTGTTCAGGGG + Intronic
1113980509 13:114270804-114270826 TAGTTTCCTCATTTGTTCAAGGG + Intronic
1114185958 14:20402601-20402623 CAGTTTTCTCACGTATTAAATGG - Intronic
1114408491 14:22478538-22478560 CAGTTTCCTCACTTGTAAAGTGG - Intergenic
1114570207 14:23661495-23661517 CAGTTTTCTCACGTGTAAAGTGG + Intergenic
1114645883 14:24255852-24255874 CAGTTTCCTCACCTGTAAAAGGG - Intronic
1114789149 14:25636394-25636416 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1115788571 14:36854487-36854509 CAGTTTCCTCATCTGTTCAATGG + Intronic
1117572117 14:57057943-57057965 CAGTGTCCTCACGTGTTAAATGG - Intergenic
1117648025 14:57872918-57872940 CAGTCTCCTCACTTGGTCACTGG + Intronic
1117905028 14:60575868-60575890 CAGTGTTCTCATGTGTACAGTGG + Intergenic
1118349051 14:64960551-64960573 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1118494252 14:66292425-66292447 CAGGTTTCTCACCTGTTAAGTGG + Intergenic
1118632808 14:67721813-67721835 CAGTTTTCTCACTTGTACAATGG - Intronic
1118728249 14:68647130-68647152 CAGTTTCCTCCAGTGATCTGAGG - Intronic
1119267049 14:73268887-73268909 CATTTTCCTCCCGTCTACAGTGG + Intronic
1119399580 14:74353368-74353390 CAGTTTCCTCACCTGTAAATTGG + Intronic
1119603729 14:75996326-75996348 CAGTTTCCTCATCTGTTGAATGG + Intronic
1119618576 14:76114569-76114591 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1119667152 14:76493099-76493121 CAGTGTCCTTGTGTGTTCAGTGG + Intronic
1120128325 14:80774080-80774102 TATTTTCCTCATGTATTCAGTGG - Intronic
1120474253 14:84967530-84967552 CAGTTTCCTCACTTGAGAAGTGG - Intergenic
1120766300 14:88329906-88329928 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1121453398 14:94023657-94023679 CGGTTTCCTCACCTGTAAAGTGG - Intergenic
1121472139 14:94164289-94164311 CAGTTTCCTCATCTGTATAGTGG - Intronic
1121496331 14:94393957-94393979 CAGTTTCCTCATCTGTTCTAAGG - Intergenic
1121632689 14:95432532-95432554 CAGTTTCCTCATTGGTTCACAGG + Intronic
1121895204 14:97640260-97640282 CTGTTTCCTCACCTGTCAAGTGG + Intergenic
1121995388 14:98598607-98598629 CAGTTTCCTCATCTGTTCAGTGG - Intergenic
1122072023 14:99211121-99211143 CAGTTTCCTCACTTGCTAAAAGG - Intronic
1122087373 14:99317095-99317117 CAGTTTCCTCACCTGTGAAATGG + Intergenic
1122262233 14:100530165-100530187 CAGTTTCCTCATCTGTAAAGTGG + Exonic
1122274947 14:100586657-100586679 CAGTTTCCTCGCCTGTAAAGGGG + Intronic
1122293315 14:100691200-100691222 CAGTTTCCTCACCTGCACATGGG + Intergenic
1122313842 14:100814075-100814097 CAGTTTCCTCATCTGTAAAGCGG + Intergenic
1122339107 14:101015423-101015445 TAGTTTCCTCACCTGTTAAATGG + Intergenic
1122353104 14:101108848-101108870 CAGTTTCCTCATCTGTACAATGG + Intergenic
1122692504 14:103537921-103537943 CAGTTTCCCTACCTGTGCAGTGG - Intergenic
1122960257 14:105090945-105090967 CCGTTTCCCCACCTGTACAGTGG + Intergenic
1123144732 14:106117535-106117557 CAGTCTCCTCCAGTGTTTAGAGG - Intergenic
1123162279 14:106289931-106289953 CAGTCTCCTCCAGTGTTTAGAGG - Intergenic
1123168058 14:106345274-106345296 CAGTCTCCTCTAGTGGTCAGAGG - Intergenic
1123194363 14:106602225-106602247 CAGTCTCCTCTAGTGGTCAGAGG - Intergenic
1202936249 14_KI270725v1_random:90346-90368 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1123805770 15:23871035-23871057 TAGTGTCCTCACTTGTGCAGTGG - Intergenic
1124379176 15:29150139-29150161 CAGTTTCCTCACCTGTGAAGTGG - Intronic
1124650914 15:31473309-31473331 CAGCTTCCTCACAGGGTCAGGGG - Intergenic
1125715055 15:41814978-41815000 CAGTTTCCTCACCTGTAAAATGG + Intronic
1125888808 15:43250359-43250381 CAGTTTCCTCAGATGTACAATGG - Intronic
1126146014 15:45473492-45473514 CAGTTTCCTCATTTGTACATCGG + Intergenic
1126259592 15:46672855-46672877 CAGTTTCCTCAAGTGTAAAATGG + Intergenic
1126686500 15:51252860-51252882 CAGATTGCACAAGTGTTCAGAGG + Intronic
1127159012 15:56160847-56160869 CAGTTTCCTAACTTGTTATGAGG + Intronic
1127668265 15:61170089-61170111 CAGTTTCCTCATTTGTCAAGTGG + Intronic
1127882598 15:63171251-63171273 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1127961247 15:63892534-63892556 CAGTTTCCTCACCTGTGAATCGG - Intergenic
1128070316 15:64791714-64791736 CAGTTTCCCCACGAGTGCAAAGG + Intergenic
1128334752 15:66778798-66778820 CAGTTTCCTCACCTGTGGAATGG + Intronic
1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG + Intronic
1128520002 15:68369022-68369044 CAGCTTCCTCATGTGTAAAGTGG + Intronic
1128664486 15:69528209-69528231 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1128703066 15:69818235-69818257 CAGTTTTCTCACCTGTAGAGTGG + Intergenic
1128761120 15:70216616-70216638 CAGTTTCCTCGCCTGTGAAGTGG + Intergenic
1129693054 15:77724595-77724617 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1129708593 15:77808725-77808747 CAGTTTCCTCATCTGTTAAATGG + Intronic
1129738482 15:77978539-77978561 CAGTTTCCTCATGTATAAAGTGG - Intergenic
1129769977 15:78196811-78196833 CAGTCTCCTCACATGTTTACAGG - Intronic
1129847588 15:78775071-78775093 CAGTTTCCTCATGTATAAAGTGG + Intronic
1130103432 15:80911638-80911660 CAGTTTCCTCACACGTGCTGTGG + Intronic
1130139134 15:81208888-81208910 CAGTTTTCTCACCTGTTAAATGG + Intronic
1130141357 15:81228892-81228914 CAGTTTTCTCACCTGTTAAATGG + Intronic
1130254315 15:82318838-82318860 CAGTTTCCTCATGTATAAAGTGG - Intergenic
1130335087 15:82951742-82951764 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1130576694 15:85099224-85099246 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1130600650 15:85271132-85271154 CAGTTTCCTCATGTATAAAGTGG + Intergenic
1130949293 15:88572977-88572999 CAGTTTCCTCACCTGCAAAGTGG + Intergenic
1130993981 15:88894182-88894204 CAGTTTCCTCAACTGTGAAGAGG - Intronic
1131028266 15:89163819-89163841 CAGTTTCCTCACCTGTAAAAGGG - Intronic
1131066643 15:89438954-89438976 CAGTTTCCTCATCTGTCAAGTGG - Intergenic
1131153141 15:90059442-90059464 CAGTTTCCTCATCTGTTAACAGG + Intronic
1131449644 15:92528590-92528612 CAGTTTCCTCATATGTTAAATGG - Intergenic
1131532714 15:93207396-93207418 CTGTTTCCTCACCTGTACAATGG + Intergenic
1131563748 15:93466764-93466786 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1131754144 15:95541950-95541972 CAGTTTCCTCACCTGTATAATGG + Intergenic
1131768718 15:95710911-95710933 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1131843590 15:96465294-96465316 CAGTTTCCTCATCTGTTGGGAGG + Intergenic
1132196373 15:99917319-99917341 CAGTTTCCCCGCCTGTGCAGCGG + Intergenic
1132347194 15:101115451-101115473 CAGTTTCCTCACCTGTAGAATGG - Intergenic
1132584171 16:699102-699124 CAGTTTCCTCATCTGTGCAGTGG - Intronic
1132873942 16:2127722-2127744 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1132909342 16:2300342-2300364 CAGTTTCCTAACCTGGTAAGTGG + Intronic
1133003756 16:2865782-2865804 CAATTTCCTCATGTGTACAGTGG - Intergenic
1133075954 16:3281549-3281571 CAGTTTCCTCATTTGTTTTGAGG - Intronic
1133333153 16:4988640-4988662 CAGTTTCCTCACGTGTGAAATGG + Intronic
1133716300 16:8452641-8452663 CAGTTTCGTCATCTGTGCAGTGG - Intergenic
1133746098 16:8687801-8687823 CAGTTTCCTCACCTGTAAAATGG + Intronic
1133840804 16:9407552-9407574 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1133852009 16:9514051-9514073 CAGTTTCCTCATCTGTTAAATGG - Intergenic
1133967017 16:10538792-10538814 CAGTTTCCTCACCTGTAAAATGG + Intronic
1134036756 16:11037055-11037077 CAGTTTCCTCACCTGTGAAGTGG - Intronic
1134068651 16:11246777-11246799 CAGTTTCCTCACTTGTGAAATGG - Intergenic
1134131483 16:11653305-11653327 CAGTTTCCCCACCTGTTAAATGG + Intergenic
1134178448 16:12028002-12028024 CAGTTTCCTCATCTGTACAGTGG - Intronic
1134197189 16:12168353-12168375 CAGTTTCCTCACATGCAAAGGGG - Intronic
1134553029 16:15146896-15146918 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1134681280 16:16127530-16127552 CAGTTTCCTCACCTGTAAAATGG - Intronic
1134684125 16:16146879-16146901 CAGTTTCCTCACCTGTGAAATGG + Intergenic
1134693751 16:16208016-16208038 CAGTTTTCTCATCTGTTCAGTGG - Intronic
1134785031 16:16934519-16934541 CAGTTTCCTCAAGTGTAAAATGG + Intergenic
1134887108 16:17803320-17803342 CAGTTTACTCATCTGTTCAATGG + Intergenic
1134978092 16:18586627-18586649 CAGTTTTCTCATCTGTTCAGTGG + Intergenic
1135239257 16:20789274-20789296 CAGTTTCCTCATGTGTCAAATGG + Intronic
1135471275 16:22733381-22733403 CAGTTTCCTCATCTGTACAATGG - Intergenic
1135545013 16:23359778-23359800 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1135779618 16:25288864-25288886 CAGTTTCCTCATTGGTTCAGTGG + Intergenic
1135810927 16:25586111-25586133 CAGTTTCCTTATGTGTTAAATGG - Intergenic
1135871106 16:26151387-26151409 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1135927249 16:26706247-26706269 CAGTTTCCTCACCTGTAAAAGGG + Intergenic
1135940672 16:26819198-26819220 CAGTCACCTCATCTGTTCAGTGG + Intergenic
1135964527 16:27024768-27024790 CAGTTTCCTCATCTGTAAAGGGG + Intergenic
1136086767 16:27890845-27890867 CACTTCCCACATGTGTTCAGAGG - Intronic
1136096417 16:27960314-27960336 CAGTTTCCTCACCTGTAAAATGG + Intronic
1136103103 16:28009851-28009873 CAGTTTCTTCACTTGTTATGTGG - Intronic
1136371796 16:29841373-29841395 CAGTTTCCTCATGTGTCAAGTGG - Intronic
1136556183 16:31009324-31009346 CAGTTTCCTCATCTGTCAAGTGG + Intronic
1136694468 16:32065436-32065458 CAGTCTCCTCCAGTGTTTAGAGG + Intergenic
1136794966 16:33008700-33008722 CAGTCTCCTCCAGTGTTTAGAGG + Intergenic
1136874947 16:33845682-33845704 CAGTCTCCTCCAGTGTTTAGAGG - Intergenic
1137264644 16:46858903-46858925 CAGTTTCCTCACCTGTACAATGG - Intergenic
1137423873 16:48360115-48360137 CAGTTTCCTAATGTGTAAAGTGG - Intronic
1137516659 16:49150331-49150353 CAATTTGCTCCAGTGTTCAGTGG + Intergenic
1137556617 16:49474294-49474316 CAATTTCCTCACCTGTGCAGTGG - Intergenic
1137582378 16:49641154-49641176 CAGTTTCCTCGTCTGTCCAGTGG - Intronic
1137612988 16:49831481-49831503 CAGTTTCCTCACCTATAAAGCGG + Intronic
1137795386 16:51213104-51213126 CAGTTTCCTCATCTGTCAAGTGG - Intergenic
1137868406 16:51925916-51925938 CAGTTTCCCCACATGTCAAGTGG - Intergenic
1138153315 16:54679354-54679376 CAGTTTCCTCATCTGTTAAACGG + Intergenic
1138237903 16:55401037-55401059 CAGTTTCCTCACTTGTCCAGTGG - Intronic
1138249760 16:55492877-55492899 CAGTTTCCTCACCTGTGAAATGG + Intronic
1138265961 16:55659865-55659887 CAGTTTCCTCACTTGTCAAATGG + Intronic
1138338494 16:56271264-56271286 CAGTTTCCTCATCTGTAAAGAGG + Intronic
1138459508 16:57139863-57139885 TAGTTTCCTCATTTGTACAGTGG + Intronic
1138741818 16:59319750-59319772 CAGTTTCCTCATCTGTACAATGG + Intergenic
1139213808 16:65107858-65107880 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1139268838 16:65663473-65663495 GAGTTTCATCAGATGTTCAGAGG + Intergenic
1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG + Intronic
1139441554 16:66970442-66970464 CAGTTTCCTCATGTGTAAAATGG - Intronic
1139693929 16:68659121-68659143 CAGTTTCCTCACCTGTAAAACGG - Intronic
1139841567 16:69885744-69885766 TAGTTTCCTTAAGTGTTAAGTGG + Intronic
1139843680 16:69903217-69903239 CAGTTTCAGCAGGTCTTCAGAGG - Intronic
1140074257 16:71682593-71682615 CAGTTTCTTCACCTGTTTTGAGG + Intronic
1140177824 16:72682439-72682461 AAGTTTCCTCATGTGTTAAATGG + Intergenic
1140211133 16:72971433-72971455 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1140879517 16:79185245-79185267 CAGTTTCCTGTCTGGTTCAGGGG - Intronic
1140946511 16:79773156-79773178 CACTTTCCTCATCTGTTAAGTGG - Intergenic
1140963063 16:79935802-79935824 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1141009669 16:80385801-80385823 CAGTTTCCTCATTTGTGAAGGGG - Intergenic
1141144525 16:81519648-81519670 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1141180934 16:81752941-81752963 CAGTTTCCTCATCTGTGTAGTGG + Intronic
1141320836 16:83007362-83007384 TAGTTTCCTCACGTGTGAAATGG - Intronic
1141475619 16:84271218-84271240 CAGTTTCCTCATCTGTACAATGG + Intergenic
1141530590 16:84643797-84643819 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1141553483 16:84821468-84821490 CAGTTTCCTCAGCTGTGAAGTGG - Intronic
1141564474 16:84892089-84892111 CAGTTTCCTCACCTATAAAGGGG + Intronic
1141707371 16:85674454-85674476 CATGTTCCACAGGTGTTCAGAGG + Exonic
1141745943 16:85926316-85926338 CAGTTTCCCCACTTGTTGTGAGG + Intergenic
1141749504 16:85948663-85948685 CAGTTTCCTCACCTGTACAGTGG + Intergenic
1141795640 16:86271826-86271848 CAGTTTCTTCATCTGTTCAGTGG - Intergenic
1142000224 16:87660100-87660122 CAGTTTCCTCATCTGTAAAGGGG + Intronic
1142000379 16:87660894-87660916 CAGTTTTCTCATCTGTCCAGTGG + Intronic
1142003436 16:87677551-87677573 CAGTTTCCTCACCTGTGCAGGGG - Intronic
1142122015 16:88391158-88391180 CAGTTTCCCCACCTGTTCAGTGG + Intergenic
1203097228 16_KI270728v1_random:1270355-1270377 CAGTCTCCTCCAGTGTTTAGAGG + Intergenic
1142503311 17:346118-346140 CAGTTTGCTCACCTGTACAATGG - Intronic
1142982995 17:3682091-3682113 CAGTTTCCTCATCTGTTAAATGG - Intronic
1143262412 17:5609453-5609475 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1143976656 17:10835378-10835400 CAGTTTCCTCACCTGCAAAGTGG - Intronic
1144469650 17:15526394-15526416 CAGTTTCCTCACTTGTTAAATGG + Intronic
1144477112 17:15597876-15597898 CAGTTTCCTCATCTGTGTAGTGG - Intronic
1144550111 17:16233136-16233158 CAGTTTCTTCACCAGTTAAGTGG - Intronic
1144784021 17:17821953-17821975 CAGTTTCTTCACGTGTAGAATGG - Intronic
1144831333 17:18132845-18132867 CAGTTTCCTCACCTGTAAAATGG + Intronic
1144926701 17:18817259-18817281 CAGTTTCCTCACTTGTTAAATGG - Intergenic
1145267541 17:21387582-21387604 CAGTTTCCTCACCTGGGAAGTGG + Intronic
1145304502 17:21665976-21665998 CAGTTTCCTCCCCTGTAAAGTGG - Intergenic
1145795844 17:27654966-27654988 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1145810299 17:27760290-27760312 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1146497680 17:33337515-33337537 CAGTTTGCTCAACTGTTCAAAGG + Intronic
1146591100 17:34128552-34128574 CAGTTTCCTCATCCTTTCAGTGG + Intronic
1146662757 17:34675482-34675504 CAGTTTCCTCACTCATACAGTGG - Intergenic
1146820331 17:35979543-35979565 CAGTTTCCTCATCTATTAAGTGG + Intronic
1146943128 17:36857581-36857603 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1147308603 17:39580199-39580221 CAGTTTCCTCATGTATGCAATGG - Intergenic
1147448479 17:40489283-40489305 CAGTTTCCACACCTGTAAAGTGG + Intronic
1147598475 17:41731871-41731893 CAATTTCCTCATTTGTTAAGAGG - Intronic
1147614456 17:41819979-41820001 CAGTGTCCTCACCTGTCAAGTGG + Intronic
1147788053 17:42994374-42994396 CAGTTTCCTCAGCTGTAAAGTGG - Intergenic
1147883306 17:43668038-43668060 CAGTTTCCTCAACTGTAAAGTGG + Intergenic
1148238052 17:45982614-45982636 CAGTTTCCTCATCTGTAAAGAGG - Intronic
1148322568 17:46766448-46766470 CAGTTTCCTCCTCTGTTCAGTGG - Intronic
1148323096 17:46769367-46769389 CAGTTTCCCCATGTGTTAAATGG - Intronic
1148343951 17:46890967-46890989 CAGTTTCCTCAACTGTCAAGTGG - Intergenic
1148355799 17:46974830-46974852 CAGTTTCCTCATCTGTACAATGG + Intronic
1148435096 17:47677838-47677860 CAGTCTCCTCATGTGTAAAGTGG + Intronic
1148847381 17:50537449-50537471 CAGTTTCCTCATCTGTACAGTGG + Intronic
1149576202 17:57715383-57715405 CAGTTTCCTCACCTGTGCAATGG - Intergenic
1150132499 17:62676736-62676758 CAGTTTTCTCATCTGTCCAGTGG + Intronic
1150144545 17:62756707-62756729 CAGTTTCCTCATCTGTACAATGG - Intronic
1150216084 17:63470693-63470715 CAGTTTCCTCATGTGTACAATGG - Intergenic
1150593002 17:66579536-66579558 CAGTTTTCACATGTGTGCAGTGG - Intronic
1150665434 17:67131688-67131710 CAGTTTCCTCATGTGCAAAGTGG + Intronic
1150702056 17:67456074-67456096 CAGTTTCCTCACTTGTAAAATGG - Intronic
1150707643 17:67501926-67501948 CAGTTTCCTCATCTGTACAAGGG + Intronic
1151337784 17:73450251-73450273 CAGTTTCCTCCTCTGTGCAGGGG + Intronic
1151360678 17:73586957-73586979 CAGTTTCCTCATCTGTCCAAGGG + Intronic
1151369914 17:73641333-73641355 CAGTTTCCTCATCTGTACACTGG - Intronic
1151486706 17:74405503-74405525 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1151705214 17:75763758-75763780 CAGTTTCCTCATCTGTACAATGG + Intronic
1151930641 17:77229652-77229674 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1152236210 17:79140202-79140224 CAGTTTCCTCACCTGTACAATGG - Intronic
1152397644 17:80044122-80044144 CAGTTTCCTCATCTGTACAATGG - Intronic
1152491247 17:80636130-80636152 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1152568660 17:81111668-81111690 CCATTTCCTCACGGGTTGAGTGG + Intronic
1152733732 17:81986651-81986673 CAGTTTCCTCACCTGTGCCCCGG + Intronic
1152892809 17:82892036-82892058 CAACTTCCTCACCTGTGCAGGGG - Intronic
1153235666 18:2984710-2984732 CAGTTTCCTCACATTTAAAGTGG - Intronic
1153337306 18:3937918-3937940 CAGTTTCCTCAGCTGTACAGTGG + Intronic
1153646997 18:7204414-7204436 CGGTTTCCTCATGTGTGCAGTGG - Intergenic
1154486298 18:14874048-14874070 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1154486692 18:14877624-14877646 CAGTTTTCTCATCTGTTCAGTGG - Intergenic
1155069300 18:22299346-22299368 CAGTTTCCTCATGTGTATAAAGG + Intergenic
1156779583 18:40835563-40835585 CAGCTTCCTCACGTGTAAATGGG - Intergenic
1157225381 18:45858324-45858346 CAGTTTCCTTACCAGTTAAGTGG - Intronic
1157426206 18:47586403-47586425 CAGTTTCCTCATGTGTAAAATGG + Intergenic
1157443921 18:47730818-47730840 CATTTTCCTCACCTGTCCATTGG - Intergenic
1157528236 18:48401422-48401444 CAGTTTCCTCACCTATGCAGTGG - Intronic
1157591623 18:48839552-48839574 CAGTTTCCTTACCTGTAAAGTGG - Intronic
1157650988 18:49330766-49330788 CAGTTTCCTCATTATTTCAGGGG - Intronic
1158401315 18:57123703-57123725 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1158538520 18:58330543-58330565 CAGTTTCCTCATCTGTTAATTGG + Intronic
1159299215 18:66541159-66541181 CAGTTTCATCACGTCTTGGGTGG - Intronic
1159869629 18:73745677-73745699 CAGTTTCCTCAACTGTACAATGG + Intergenic
1160144423 18:76351940-76351962 CAGTTTCCACAGCTGTGCAGTGG - Intergenic
1160400873 18:78610618-78610640 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1160583732 18:79901486-79901508 CAGTTTCCTCATGGGGTGAGGGG + Intergenic
1160699787 19:500356-500378 CAGCTTCCTCATCTGTCCAGTGG + Intronic
1160919099 19:1511669-1511691 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1160924097 19:1534880-1534902 CAGTTTCCCCAGGTGTACAGTGG + Intronic
1160953636 19:1679492-1679514 CAGTTTCCCCATCTGTCCAGCGG - Intergenic
1160965185 19:1744323-1744345 CAGTTTGCTCACCTGTGAAGTGG + Intergenic
1161054776 19:2184864-2184886 CGGTTTCCTCACGTTTTTAAGGG + Intronic
1161229204 19:3164086-3164108 CGGTTTCCTCACCTGTAAAGTGG - Intergenic
1161292080 19:3499924-3499946 CAGTTTCCTCACCTGTAAAATGG - Intronic
1161320667 19:3639365-3639387 CAGTTTCCTCATCTGTCAAGTGG + Intronic
1161482489 19:4517944-4517966 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1161517034 19:4702329-4702351 CAGTTTCCTCCCCTGTGCAGTGG + Intronic
1161566458 19:5005508-5005530 CAGTTTCCTCATCTGTAAAGGGG - Intronic
1161609823 19:5236268-5236290 CAGTTTCCTCACCTGTAAAATGG - Intronic
1161616911 19:5276025-5276047 CAGTTTCCTCACATGTAAAATGG - Intronic
1161701491 19:5798288-5798310 CAGTCTCCCCACCTGCTCAGGGG - Intergenic
1161709982 19:5842190-5842212 CAGTTTCCCCATCTGTACAGTGG - Intergenic
1161763302 19:6190260-6190282 CAGTTTCCTCACCTGTAAAATGG + Intronic
1161787496 19:6336430-6336452 CAGTTTCCTCACCTGTAAGGTGG + Intergenic
1161895329 19:7075385-7075407 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1162095386 19:8306947-8306969 CAGTTTCCTCACCTGTAAACGGG + Intronic
1162477321 19:10908312-10908334 CAGTTTCCTCATCTGTGAAGCGG + Intronic
1162569956 19:11465958-11465980 CAGTTTCCTCACCTGTCAATGGG - Intronic
1162571109 19:11473655-11473677 CAGTTTCCTCATGTATTAAGTGG - Intronic
1162868752 19:13569544-13569566 CAGTTTCCTCACCTGTAAAATGG - Intronic
1162998485 19:14351206-14351228 CAGTTTCCTCACTTGTTAAATGG + Intergenic
1163013090 19:14437557-14437579 CAGTTTCCTCACCTGTGAAGTGG + Intronic
1163041552 19:14606739-14606761 CAGTTTCCTCACCTGTAAAATGG - Intronic
1163155196 19:15436424-15436446 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1163270206 19:16248477-16248499 CAGTTTCCCCATGTGTGCAATGG - Intergenic
1163335610 19:16669654-16669676 CAGTTTCCTCCCCTGTTAAATGG - Intronic
1163404006 19:17111221-17111243 CAGTTTCCTCACATGTCAGGTGG - Intronic
1163443628 19:17334157-17334179 CAGTTTCCTCACCTGTGAAATGG - Intronic
1163655259 19:18542112-18542134 CAGTTTCCTCATCTATACAGTGG + Intronic
1164402613 19:27911995-27912017 CAGTTTCCTCACCTGACCAGGGG + Intergenic
1165059275 19:33196947-33196969 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1165342786 19:35224651-35224673 CAGTTTCCTCATCTGTTCTATGG + Intergenic
1165655323 19:37527531-37527553 TAGTTTCCTCATCTGTTCAATGG - Intronic
1165707007 19:37983354-37983376 CAGTTTTCTCATCTGTTAAGTGG + Intronic
1165892130 19:39119586-39119608 CAATTTCCTCATCTGTTAAGTGG + Intergenic
1165961498 19:39538610-39538632 TAGTTTCCTTACGTGTACACAGG - Exonic
1166001324 19:39879239-39879261 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1166004107 19:39895490-39895512 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1166068501 19:40374312-40374334 CAGTTTCCTCACATGTGAAATGG + Intronic
1166189654 19:41167589-41167611 CGGTTTCCTCACGTGTAAAATGG + Intergenic
1166215896 19:41334833-41334855 CAGTTTCCTCATCTGTTCAGAGG + Intronic
1166374394 19:42319273-42319295 CAGTTTCCTCACCTTTTAATGGG + Intronic
1166657872 19:44625534-44625556 CAGTTTCCTCATGTGTATAATGG + Intronic
1166800948 19:45456519-45456541 CAGTTTCCTCATCTGTTGAGTGG + Intronic
1167188521 19:47965810-47965832 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1167207468 19:48112297-48112319 CAGTGTCCTCACCTGTTAAATGG + Intergenic
1167248560 19:48389295-48389317 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1167301293 19:48679434-48679456 CTGTTTCCTCACCTGTTAAATGG - Intergenic
1167663308 19:50809065-50809087 CAGTTTCCTCATCTGTAGAGTGG + Intergenic
1167765727 19:51480946-51480968 CAGTTTCCTCATCTGTAGAGTGG + Intronic
1168231426 19:55034767-55034789 CAGTTTCCTTATGTTTACAGTGG - Intronic
1168245705 19:55112315-55112337 CAGTTTCCTCACCTGTGAAATGG - Intronic
1168294463 19:55372097-55372119 CAGTTTCCTCATCTGTGAAGGGG + Intergenic
1168470000 19:56632007-56632029 CAGTTTCCTCATCTGTAGAGTGG + Intergenic
1168631260 19:57958181-57958203 CAGTTTCCTCATGTGTACAAAGG + Intergenic
1202677600 1_KI270711v1_random:21870-21892 CTGTTTCCTCACCTGTTCAGAGG - Intergenic
1202678389 1_KI270711v1_random:28213-28235 CAGTTTCCTCATCTGTTCAGAGG - Intergenic
1202684298 1_KI270712v1_random:35159-35181 CAGTTTCCTCATGTGTGAAATGG - Intergenic
926145912 2:10397083-10397105 CAGTTTCCTGACCTGTCTAGGGG - Intronic
926711603 2:15886578-15886600 CAGTTTTCTCATGTGTAAAGTGG + Intergenic
926716218 2:15926015-15926037 CAGTTTCCTCAGATGTAAAGTGG + Intergenic
927043812 2:19256619-19256641 CTGTTTTCTCACATGTTCAAAGG + Intergenic
927789744 2:26001031-26001053 CCTTTTCCTCCCCTGTTCAGTGG - Intergenic
928242804 2:29601337-29601359 CGGTTTCCCCATGTGTTCACAGG + Intronic
928258542 2:29746090-29746112 CAGTTTCCTCATCTGTAAAGTGG - Intronic
928339148 2:30426461-30426483 CAGTTTCCTCATCTGTACAAAGG + Intergenic
928359857 2:30654413-30654435 CAGTTTCCTCACCTGTAAAATGG - Intergenic
928376591 2:30779335-30779357 CAGTTTCCTCATGTGTAAAATGG + Intronic
928399104 2:30965272-30965294 CAGTTTCCTCAGCTGTGAAGTGG + Intronic
928447751 2:31348083-31348105 CAGTTTCCTCATCTGTGCAAAGG - Intronic
928993922 2:37266167-37266189 CATTTACCTCACTTTTTCAGAGG - Intronic
929435450 2:41925338-41925360 CAGTTTCCTCATCTGTACAAGGG - Intergenic
929588276 2:43129699-43129721 ATGTTTCCTCACCTGTTGAGTGG - Intergenic
929639970 2:43568145-43568167 CAGCTTTCTCACTTGTTAAGTGG + Intronic
929714198 2:44293859-44293881 CAGTTTCCTCACTGGTAAAGGGG + Intronic
929783874 2:44975344-44975366 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
930263558 2:49174226-49174248 CAGTTTCCTTATCTATTCAGAGG + Intergenic
930792003 2:55342486-55342508 GAGTTTCCTTACTTGTTAAGTGG - Intronic
932761783 2:74442520-74442542 CAGTTTTCTCATTTGTTCAGTGG + Intergenic
934247421 2:90319688-90319710 CAGTTTCCTCATGTGTGAAATGG + Intergenic
934261904 2:91482915-91482937 CAGTTTCCTCATGTGTGAAATGG - Intergenic
934304945 2:91813904-91813926 CAGTTTCCTCATGTGTGAAATGG - Intergenic
934328312 2:92038844-92038866 CAGTTTCCTCATGTGTGAAATGG + Intergenic
934466691 2:94269385-94269407 CAGTTTCCTCATGTGTGAAATGG + Intergenic
934687372 2:96331553-96331575 CAGTTTCCTCACATGTAAAATGG - Intergenic
934709857 2:96507847-96507869 CAGTTTCCCCACGTGTATAATGG - Intronic
934950289 2:98571255-98571277 CAGTTTCCTCACCTGCCAAGTGG - Intronic
934974680 2:98792525-98792547 CAGTTTCCTCACCTGCAAAGTGG + Intergenic
935043038 2:99452960-99452982 CAGTTTCCTCACATGTAAACTGG + Intronic
935233089 2:101116399-101116421 CAGCTTCCTCATGTGTCCAACGG + Intronic
935289406 2:101597015-101597037 CAGTTCCCTCACCTGGACAGTGG + Intergenic
935289526 2:101598333-101598355 CAGTTCCCTCACTTGGACAGTGG - Intergenic
935389909 2:102540137-102540159 CAGTTTCCTCTTCTGTACAGTGG - Intergenic
935418835 2:102845744-102845766 CAGTTTTTTCACCTGTACAGTGG + Intergenic
936339893 2:111621944-111621966 CAGTTTCTTCCTGTGTTAAGTGG + Intergenic
937086792 2:119177240-119177262 CAGTTTTCTCACCTGGTCAATGG + Intergenic
937276261 2:120686001-120686023 CAGTTTCCTCACCTGTGAACCGG - Intergenic
937292145 2:120788105-120788127 CAGTTTCCTCATCTGTTAAGTGG - Intronic
937876833 2:126832359-126832381 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
938093893 2:128449474-128449496 CAGTTTCTTCACCTGTAAAGCGG + Intergenic
938100450 2:128494466-128494488 CAGTTTCCTCACATGTAAAATGG + Intergenic
938106083 2:128530656-128530678 CAATTTCCTCACTTGTAAAGTGG - Intergenic
938246053 2:129778836-129778858 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
939253504 2:139714078-139714100 CAGTTTCCTCATTTGTTAAATGG + Intergenic
939429007 2:142078566-142078588 CAGTTTCCTGCCCTGTACAGCGG + Intronic
939590913 2:144062354-144062376 CAGTTTCCTCATCTGTCCAATGG - Intronic
939591333 2:144067138-144067160 CAGTTTCCTCATCTGTTAAATGG - Intronic
939896282 2:147795107-147795129 CAGTTTCCTCATCTGTACAATGG - Intergenic
940115655 2:150205441-150205463 CAGTTTCCTAATCTGTTAAGTGG - Intergenic
941094862 2:161227509-161227531 CAGTTTCTTCACATGTAAAGTGG + Intronic
941515531 2:166471285-166471307 CAGTTTCCTCAACTGTAAAGTGG + Intronic
942430703 2:175908048-175908070 CAGTTTTCTCATCTGTTAAGTGG + Intergenic
942606000 2:177691654-177691676 CAGTTTCCTCATGTGTACTGTGG + Intronic
943341615 2:186689448-186689470 CAGTTTCCTCAACTGTATAGGGG - Intergenic
945185425 2:207134827-207134849 CAGTTTCCTCACCTGTAAAATGG + Intronic
945503461 2:210607709-210607731 CAGTTTCCTCATTTGTTAGGTGG + Intronic
945670987 2:212802487-212802509 CAGTTTCCTCACACTTTGAGGGG + Intergenic
946032578 2:216716784-216716806 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
946611178 2:221459481-221459503 CATTTTCCTCAGATGTTCAGTGG - Intronic
946821562 2:223634869-223634891 CAGTTTTCTCAACTGTACAGTGG - Intergenic
947220726 2:227789594-227789616 CAGATTCCTCACTTGTTAAATGG + Intergenic
947675271 2:231973098-231973120 TAGTTTCCTTAAATGTTCAGTGG + Intronic
948244638 2:236469456-236469478 CTGTTTCCTCATCTGTTAAGTGG - Intronic
948466640 2:238155334-238155356 CAGTTTCCTCATCTGTGCAATGG + Intergenic
948822785 2:240558248-240558270 CAGTTTCCTCAGGTGTCCCACGG - Intronic
948984065 2:241509211-241509233 CAGTTTCCTTACCTGTCAAGGGG + Intronic
1168841531 20:912972-912994 CTGTTTCCTCACCTGTACACTGG + Intronic
1168904470 20:1392534-1392556 CAGTTTCCTCATCTGTGCAGCGG + Intronic
1168970352 20:1926680-1926702 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1168978551 20:1986182-1986204 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1169324763 20:4666278-4666300 CAGTCTCCTCAAGTATTCTGGGG - Intergenic
1169730531 20:8780821-8780843 CAATTTTCTCACCTGTTCAATGG + Intronic
1169746483 20:8948169-8948191 CAATTTCCTCACCTGTACAGTGG - Intronic
1169866326 20:10203734-10203756 CAGTTTACTCATTTGTTCAATGG + Intergenic
1169924966 20:10773569-10773591 CAGTTTCCTCATCTGTTGATGGG + Intergenic
1170341560 20:15333650-15333672 CAGTTTCCTCATATGTACAATGG + Intronic
1170554322 20:17503560-17503582 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1170666980 20:18394847-18394869 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1170746777 20:19106608-19106630 CAGTTTCCTCACCTGTGCAATGG - Intergenic
1170882113 20:20305812-20305834 CAGTTTGCTCACGTACTCTGGGG + Intronic
1171409055 20:24933981-24934003 CAGTTTTCTCATGTGTAAAGTGG + Intergenic
1171522021 20:25783415-25783437 CAGTTTCCTCCCCTGTAAAGTGG - Intronic
1171529772 20:25845360-25845382 CAGTTTCCTCCCCTGTAAAGTGG - Intronic
1171554804 20:26072468-26072490 CAGTTTCCTCCCCTGTAAAGTGG + Intergenic
1172020354 20:31909546-31909568 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1172048960 20:32101640-32101662 CAGTTTCCTCATCTGTCCAGTGG + Exonic
1172099609 20:32477263-32477285 CAGTTTCCTCATCTGTGGAGCGG - Intronic
1172126792 20:32629235-32629257 CAGTTTCCTCACCTCTGCAATGG - Intergenic
1172212544 20:33211145-33211167 CAGTTTTCTCACTTATTCAAGGG - Intergenic
1172215648 20:33233818-33233840 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1172312233 20:33927610-33927632 CTGTTTCCTCATCTGTCCAGTGG - Intergenic
1172453008 20:35041816-35041838 CAGTTTCCTCACATGTGCAATGG + Intronic
1172657475 20:36545982-36546004 CAGTTTCCCCATCTGTGCAGTGG - Intronic
1172684733 20:36745511-36745533 CAGTTTCCTCGGCTGTTAAGTGG + Intronic
1172873775 20:38151940-38151962 CAGTTTCTTCACCGGTTAAGTGG - Intronic
1172874539 20:38156240-38156262 CAGTTTCCTCATCTGTAAAGGGG + Intronic
1172883984 20:38219294-38219316 CAGTTTCCTCATCTGTGCAGTGG + Intronic
1173089313 20:39955159-39955181 CAGTTTCCTCATCTGTTCAATGG - Intergenic
1173247545 20:41347029-41347051 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1173367299 20:42398001-42398023 CAGTTTCCTCAAATTTACAGTGG - Intronic
1173550135 20:43927243-43927265 CACTTTCCTCAGGTTTCCAGGGG + Intronic
1173578374 20:44128327-44128349 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1173645261 20:44629313-44629335 CAGTTTCCCCATCTGTCCAGTGG - Intronic
1173705398 20:45106743-45106765 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1173794752 20:45851653-45851675 CAGTTTCCTCATCTGTACAATGG - Intronic
1173851983 20:46224431-46224453 CAGTTTCCCCATGTGCACAGGGG - Intronic
1173958944 20:47056596-47056618 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1174059944 20:47825802-47825824 CAGTTTCCTCATCTGTATAGTGG - Intergenic
1174071927 20:47905468-47905490 CAGTTTCCTCATCTGTATAGTGG + Intergenic
1174152121 20:48493201-48493223 CAGTTTCCTCATCTGTATAGTGG - Intergenic
1174300601 20:49579573-49579595 CAGTTTCCTCACCTGGAAAGTGG - Intergenic
1174396610 20:50250649-50250671 CAGTTTCCCCATCTGCTCAGTGG - Intergenic
1174417344 20:50376371-50376393 CAGTTTCCTCATCTGTTAAATGG + Intergenic
1174550110 20:51356079-51356101 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1174844204 20:53927699-53927721 TAGTATCCTCACGTGTCCTGGGG + Intergenic
1174855260 20:54038557-54038579 CAGTTTCCCAACCTGTTCATTGG - Intronic
1175049782 20:56144411-56144433 CATTTTCCTTACGTGTAAAGTGG - Intergenic
1175150866 20:56932875-56932897 CTGTTTCCTCACCTGTGCAATGG - Intergenic
1175240261 20:57542239-57542261 CAGTTTCCTCATGTGTAAAATGG + Intergenic
1175270628 20:57731427-57731449 CAGTTTCCTCACCTGTACAATGG + Intergenic
1175349129 20:58306085-58306107 CAGTTTTCTCATCTGTTAAGAGG + Intergenic
1175632348 20:60552212-60552234 CAGTTTCCTCATTTGTTAAAAGG + Intergenic
1175827108 20:61942294-61942316 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1175913303 20:62414643-62414665 CAGTTTCCTCGCCTGTGGAGTGG - Intronic
1175967376 20:62666282-62666304 CAGTTTCCCCACCTGTAAAGTGG + Intronic
1176047030 20:63097967-63097989 CAGTTTCCCCATCTGTGCAGTGG + Intergenic
1176587251 21:8599259-8599281 CAGTTTCCTCATGTGTGAAATGG - Intergenic
1176794610 21:13361775-13361797 CAGTTTTCTCATCTGTTCAGTGG + Intergenic
1177216032 21:18130186-18130208 CAGTTTCCTTACTTGTAAAGTGG + Intronic
1178232977 21:30808597-30808619 CAGTTTCCTCAAGTGTAAAATGG + Intergenic
1178872915 21:36390963-36390985 CAGTTTCCTCACCTGTAAATGGG - Intronic
1179017826 21:37608637-37608659 CAGTTACTTCACGTGTGAAGTGG + Exonic
1179262968 21:39774919-39774941 CAGTTTTCTCACCTGTAAAGTGG + Intronic
1179503885 21:41827080-41827102 CAGTTTTCTCACCTATGCAGGGG - Intronic
1179545555 21:42110648-42110670 CAGTTTCCTCATTTATCCAGTGG + Intronic
1179801147 21:43811996-43812018 CAGTTTCCTCACCTGCACAAAGG + Intergenic
1180248355 21:46563254-46563276 CAGTTTCCTCACGTATGAAATGG - Intronic
1180270082 22:10576256-10576278 CAGTTTCCTCATGTGTGAAATGG - Intergenic
1180280600 22:10690022-10690044 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1180587822 22:16908560-16908582 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1180817755 22:18802759-18802781 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1180927475 22:19566329-19566351 CAGTTTCCTCAGCTGTGCAAAGG - Intergenic
1181117510 22:20642122-20642144 TAGTTTCCTCATCTGTTAAGTGG + Intergenic
1181203971 22:21237212-21237234 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1181522958 22:23459912-23459934 TAGTTTCCCCACTTGTGCAGGGG - Intergenic
1181622524 22:24100816-24100838 CAATTTCCTCACCTGTTGAATGG + Intronic
1181682023 22:24501888-24501910 CAGTTTCCTCACCTGGTAATGGG - Intronic
1181747341 22:24964755-24964777 CAGTTTCCTCACCTGTAAAATGG - Intronic
1181780033 22:25185780-25185802 CAGTTTCCTCAACTGTAAAGTGG + Intronic
1181801347 22:25349502-25349524 CAGTTTCCTCATCTGTACGGGGG + Intergenic
1181815135 22:25431447-25431469 CAGTTTCCTCCTCTGTACAGGGG + Intergenic
1181865667 22:25852862-25852884 CAGTTTCCTCATGTGTAAAGTGG + Intronic
1181966829 22:26662344-26662366 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1182093043 22:27609059-27609081 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1182118585 22:27772706-27772728 CAGTTTCCTCACCTGTCAAATGG + Intronic
1182243757 22:28938521-28938543 CAGTTTCCTCATCTGTTAACAGG - Intronic
1182432246 22:30306244-30306266 CAGTTTCTTCATCTGTGCAGTGG - Intronic
1182468976 22:30535487-30535509 CAGTTTCCTCATCTGTTTATAGG - Intronic
1182794919 22:32984930-32984952 CAGTTTCCTCATTTGTCAAGTGG + Intronic
1183044175 22:35206549-35206571 CAGTTTCCTCACCTGTTAAATGG + Intergenic
1183157418 22:36086033-36086055 CAGTTTCCTCACCTGTCAAGTGG - Intergenic
1183206225 22:36421022-36421044 CAGTTTCCTCATGTGTAAAGTGG + Intergenic
1183309979 22:37104171-37104193 CAGTTTCCTTATCTGTTCAATGG - Intronic
1183349229 22:37325328-37325350 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1183361093 22:37383955-37383977 CAGTTTCCTCATCTGTTTGGAGG + Intronic
1183367514 22:37415014-37415036 CAGTTTCTTCACCTGTACAATGG - Intronic
1183381418 22:37492259-37492281 CAGTTTCCTCACCTGTTGCCTGG - Intronic
1183405005 22:37626083-37626105 CAGTTTCCTCAGTTGTGAAGTGG - Intronic
1183458257 22:37934360-37934382 CAGTTTCCCCACGTGTAGACTGG + Intronic
1183486091 22:38088576-38088598 CAGTTTCCTCATTCATTCAGTGG - Intronic
1183509866 22:38228367-38228389 CAGTTTCCTCACCTGTACCATGG - Intronic
1183548431 22:38467781-38467803 CAGTTTCCTCATCTGTACACAGG - Intergenic
1183597181 22:38819610-38819632 CAGTTTCCTCACCTGTCTAACGG + Exonic
1183672293 22:39280167-39280189 CAGTTTCCTCATGTGTAGACAGG - Intergenic
1184062440 22:42091619-42091641 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1184118405 22:42435147-42435169 CAGTTTCCTCATCTGTACAATGG - Intergenic
1184156916 22:42673835-42673857 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1184221124 22:43100661-43100683 CAGTTTCCTCTCCTGTAAAGTGG + Intergenic
1184286577 22:43475230-43475252 CAGTTTCCTCACCTGTAAAATGG - Intronic
1184526085 22:45023776-45023798 CAGTTTCCTCACCTATACAGTGG - Intergenic
1185041793 22:48507945-48507967 CAGTGTCCTCATCTGTGCAGTGG + Intronic
1203222950 22_KI270731v1_random:58203-58225 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1203267879 22_KI270734v1_random:28610-28632 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
949373835 3:3364996-3365018 CAGTTTCCTCACCTGTAAAATGG + Intergenic
949606658 3:5660831-5660853 CAGTTTCCTCAGGTGTTTCCAGG - Intergenic
949920442 3:8996099-8996121 CAGTTTCCTCATCTGTTAAATGG + Intronic
950038937 3:9907161-9907183 CAGTTTCCTCATTTGTACAATGG - Intronic
950053434 3:10008593-10008615 CAGTTTCCTCACCTGGACAGTGG - Intronic
950138266 3:10598349-10598371 CAGTTTACTCACCTGTGAAGTGG + Intronic
950159135 3:10746354-10746376 CAGTCTCCTCACCTTTTAAGTGG - Intergenic
950183505 3:10931213-10931235 CAGTTTCCCCATGTGAACAGTGG + Intronic
950184560 3:10937206-10937228 CAGTTTCCTCATCTGTAAAGGGG - Intronic
950305072 3:11910878-11910900 CAGTTTCCTCACCTGGACAGTGG - Intergenic
950305864 3:11915028-11915050 CAGTTTCCTCACCTTTACAGTGG - Intergenic
950447799 3:13048169-13048191 CAGTTTCCTCATGTGTAAAATGG + Intronic
950563059 3:13746930-13746952 CAGTTTCCTCATCTGTAGAGGGG - Intergenic
950581171 3:13863035-13863057 CAGTTTCCTCATTTGTAAAGTGG + Intronic
950645887 3:14376542-14376564 CAGTTTCCTCATCTGTGAAGTGG + Intergenic
950666240 3:14496877-14496899 CAGTTTCCTCATCTGTAAAGTGG - Intronic
950668797 3:14512989-14513011 CAGTTTCCTCCTCTGTTGAGAGG - Intronic
950676833 3:14559142-14559164 CAGTTTCCTCACCTATAAAGTGG + Intergenic
950718227 3:14864598-14864620 CAGTTTCCTCATCTGTGAAGTGG + Intronic
950988419 3:17402519-17402541 CAGTTTCCTCTTGTGTTAAATGG - Intronic
951710517 3:25581558-25581580 CAGTTTCCTCACCTGTAAAAAGG - Intronic
952760443 3:36908829-36908851 CAGTTTCCTCATCTGAACAGTGG - Intronic
952906364 3:38141595-38141617 CAGTTTCCTCACTTGAGGAGTGG + Exonic
953410313 3:42687171-42687193 CAGTTTCCTCATCTGTACAATGG - Intronic
953840180 3:46383673-46383695 CAGTTTCCTCTCCTTCTCAGAGG - Intergenic
954300671 3:49699295-49699317 CACATTCCTCATCTGTTCAGTGG - Intronic
954458711 3:50613781-50613803 CAGTTTTCTCACCTGTAAAGAGG - Exonic
954581972 3:51707791-51707813 CAGTTTCCTTTCCTGTTCTGAGG + Intronic
954630397 3:52044878-52044900 CCGTTTCCTCATCTGTACAGTGG - Intergenic
954710638 3:52503633-52503655 CAGTTTCCCCACTTGTAAAGTGG + Intronic
954806390 3:53223442-53223464 CAGTTTCCTCATTTGTTCAGTGG - Intergenic
954923543 3:54212843-54212865 CAGTTTCCTCAAGTGTGAACTGG + Intronic
954995157 3:54874660-54874682 CAGTTTCCTCACCTGTACAATGG - Intronic
955029457 3:55202209-55202231 TCGTTTCCTCACCTGTTAAGTGG + Intergenic
955053481 3:55435004-55435026 CAGTTTCCTCACCTGTGAAATGG + Intergenic
955350196 3:58187984-58188006 CAGTTTCCTCACCTGTAAACAGG + Intergenic
955523186 3:59794964-59794986 CAGTTTCCTCACCTGTAAAGTGG + Intronic
956173650 3:66453398-66453420 CAGTTTCCTCATTGGTGCAGTGG - Intronic
956540608 3:70333997-70334019 AAGCTTCCTCACTTGTTCAATGG + Intergenic
956632108 3:71326964-71326986 TAGTTTCCTCATCTGTTCAATGG - Intronic
956715083 3:72072103-72072125 CAGTTTCCTCACCTGTCAAATGG + Intergenic
956724180 3:72143612-72143634 CAGTTTCCTCACCTGTAAAATGG + Intergenic
956748510 3:72328517-72328539 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
956819177 3:72937536-72937558 CAGTTTCCTCATTTGTAAAGAGG - Intronic
956857891 3:73293994-73294016 CAATTTCCTCACATGTAAAGAGG - Intergenic
957944821 3:87050648-87050670 CAGTTTCCCCACATGTGCAATGG - Intergenic
958982227 3:100735493-100735515 CAGTTTCCTCATCTGTACAAAGG - Intronic
960985549 3:123278157-123278179 CAGTTTCCTCAGATGTAAAGTGG + Intergenic
961410711 3:126718424-126718446 CAGTTTCCTCATCTGTTAAATGG - Intronic
961414177 3:126745359-126745381 CAGTTTCCTCACATGTCAAATGG + Intronic
961467648 3:127091308-127091330 CTGTTTCCTCTCGTATTAAGTGG + Intergenic
961569900 3:127790178-127790200 CAGTTTCCTCATCTGTGAAGTGG + Intronic
961634662 3:128325427-128325449 CAGTTTCCTCAGGTGTCAGGTGG + Intronic
961640685 3:128363123-128363145 CAGTCTCCTCAGCTGTACAGCGG - Intronic
961713176 3:128842595-128842617 CGGTTTCCTCACCTGGACAGTGG + Intergenic
961787936 3:129358751-129358773 CAGTTTTCTCACCTGTAAAGTGG - Intergenic
961794160 3:129397524-129397546 CAGTTTCCTCACCTGTAAAATGG + Intergenic
961819884 3:129570619-129570641 CAGTTTCCTCATATGTCAAGTGG + Intronic
961871348 3:129990604-129990626 CAGTTTCCTCATCTGTCAAGTGG - Intergenic
962000009 3:131285979-131286001 CAGTTTCTTCACCTGTACAATGG + Intronic
962058245 3:131897302-131897324 CAGTTTTCTCACCTGTAGAGTGG + Intronic
962522428 3:136209725-136209747 CAGTTTCCTCATGTGTGAAATGG - Intergenic
962920284 3:139944167-139944189 CAGTTTCCTCATCTGTAAAGGGG - Intronic
962924258 3:139977148-139977170 CTGTTTCCTCAAGTGTTCCTGGG + Intronic
962926065 3:139994400-139994422 CAGTTTCCTCATCAGTTAAGTGG - Intronic
963270879 3:143284806-143284828 CTGTTCAGTCACGTGTTCAGGGG + Intronic
963725765 3:148919618-148919640 CAGTGTCCACAAGTGTTCATTGG - Intergenic
963983279 3:151563902-151563924 CAGTTTCCTCACCTGTGAAATGG - Intergenic
964107801 3:153057537-153057559 AAGTTTCCTCACCTGTAAAGTGG - Intergenic
964172014 3:153782312-153782334 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
964429257 3:156587724-156587746 CAGTTTTCTCATATGTTCAATGG - Intergenic
964497618 3:157310418-157310440 CAGTTTCTTTACTTGTACAGTGG - Intronic
965689357 3:171338871-171338893 CAGTTTCCTCACCTGTAAATTGG - Intronic
965879934 3:173376666-173376688 CTGTTTCCTCAGCTGTGCAGTGG + Intergenic
966423547 3:179757364-179757386 CAGTTTCCTCATGTGTGAATGGG + Intronic
966614665 3:181900433-181900455 CAGTGTCCTCATCTGTTAAGTGG + Intergenic
966740216 3:183225663-183225685 CAGTTTCCTCATCTGTTAAGTGG + Intronic
967241114 3:187440650-187440672 CAGTTTCCTCCCCTGTCCAATGG + Intergenic
967279668 3:187809788-187809810 CAGTTTCCTCACCTGTGAAATGG - Intergenic
967316031 3:188153303-188153325 CAGTTTCCTCACGTGCCAAGCGG + Intronic
967770831 3:193331854-193331876 CAGTTTCCTTACCTGTTAAATGG - Intronic
967846075 3:194044131-194044153 CAGTTTCCTCATGTGTAAAATGG + Intergenic
968231439 3:197007044-197007066 CAGTTTCCTCACCTGTAAAATGG - Intronic
968274831 3:197432748-197432770 CAGTTTCCTCATTTGTAAAGTGG + Intergenic
968658184 4:1787555-1787577 CAGTTTCCCCACCTGTCAAGTGG + Intergenic
968704379 4:2071178-2071200 CAGTTTCCCCACGTGCAAAGAGG + Intergenic
968812441 4:2806057-2806079 CAGTTTCCTCACTTGAGCAGTGG - Intronic
969040063 4:4289195-4289217 CAGTTTGCTCATCTGTTTAGTGG - Intronic
969216825 4:5729838-5729860 CAGTTTCCTTACGTGTAAAGTGG - Intronic
969225361 4:5793778-5793800 CAGTGTCCTCATCTGTACAGTGG + Intronic
969227744 4:5810174-5810196 CAGTTTCCTCATTAGTTGAGTGG + Intronic
969229515 4:5820130-5820152 CAGTTTCCTCATCTGTACAATGG + Intronic
969243724 4:5918980-5919002 CAGTTTCCCCATCTGTGCAGAGG - Intronic
969257260 4:6010946-6010968 CAGTTTCCTCATCTGTGAAGTGG - Intergenic
969276097 4:6136933-6136955 CAGTTTCCTCATCTGTACAATGG - Intronic
969300179 4:6292901-6292923 CGGTTTCCTCACGGGCCCAGTGG - Intronic
969326336 4:6446479-6446501 CAGTTTCCTCATCTGTACAACGG + Intronic
969332300 4:6482299-6482321 CAGTTTCCTCATTTGTACAAGGG - Intronic
969378451 4:6778617-6778639 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
969428240 4:7138323-7138345 CAGTTTCCTCATCTGTACGGGGG + Intergenic
969442171 4:7223914-7223936 CAGTTTTCTCGTCTGTTCAGAGG + Intronic
969446168 4:7245844-7245866 CAGTTTCCTCATCTGTAAAGGGG - Intronic
969503108 4:7566486-7566508 CAGTTTCCTCATCTGTAAAGTGG - Intronic
969530495 4:7727742-7727764 CAGTTTTCTCACATGTAAAGTGG - Intronic
969596711 4:8153156-8153178 CAATTTCCTCTCGAGCTCAGAGG + Intronic
969672333 4:8596665-8596687 CAGTTTCCTCATGTGTAGATTGG - Intronic
970171269 4:13292882-13292904 CAGTTTCCTCACCTGTAAATTGG - Intergenic
970171356 4:13294014-13294036 CAGTTTCCTCATCTGTGAAGTGG + Intergenic
970323032 4:14894280-14894302 CAGTTTTCTCATCTGTTAAGTGG + Intergenic
970518394 4:16858173-16858195 CAGTTTCCTCATCTGTAAAGTGG - Intronic
970644379 4:18103328-18103350 CAGTTTCCTCACGTGTGAAATGG + Intergenic
970701401 4:18744512-18744534 CAGTTTCCTCACTTTTTAAATGG - Intergenic
970920940 4:21394303-21394325 CAGTTTTCTCACTTCTTCGGGGG + Intronic
970927663 4:21471709-21471731 CAGTTTCCTCACCTGTGAAATGG - Intronic
970970782 4:21980941-21980963 CCGTTTTCTCATCTGTTCAGTGG - Intergenic
971008994 4:22409528-22409550 CAGTTTCCACATCTGTACAGTGG + Intronic
971236549 4:24847652-24847674 CAGTTTCCTCATCTGTAAAGTGG - Intronic
971265016 4:25089563-25089585 CAGTTTCCTCATCTGTTAAATGG + Intergenic
971302406 4:25452674-25452696 CAGTTTCCTCATCTGTTAAATGG - Intergenic
971385743 4:26139208-26139230 CAGTTTCCTCATCTGGGCAGTGG + Intergenic
972011883 4:34193046-34193068 CAGTTTCCTCACCTGTAAAATGG - Intergenic
972241459 4:37197842-37197864 CAGTTTCCTTATCTGTGCAGTGG - Intergenic
972297448 4:37753574-37753596 CAATTTCCTCACGGGTCAAGTGG + Intergenic
972362975 4:38345925-38345947 CAGTTTCCTCTGGTGCTCAGTGG + Intergenic
972555779 4:40179554-40179576 CAGTTTCCTCAACTGTTAAATGG - Intergenic
972796546 4:42426545-42426567 CAGTTTCCTCAGCTGTACAGTGG + Intronic
973173729 4:47177731-47177753 CAGTTTCCTCACTTATAAAGTGG + Intronic
973989944 4:56394824-56394846 CAGTTTCCCCACATGTGCAATGG - Exonic
973993017 4:56430367-56430389 CAGTTTCCTCATCTGTACATTGG - Intronic
974101934 4:57426593-57426615 CAGTTTCCTCACCTGTAAAACGG + Intergenic
975202573 4:71608680-71608702 CAGTTTCCTCAACTGTTAAGTGG + Intergenic
975263088 4:72328583-72328605 CAGTTTCCTCACCTGTAAACTGG + Intronic
975280108 4:72552255-72552277 CAGTTTCCTCAACTGTTAACTGG + Intronic
975326002 4:73059341-73059363 CAGTTTCCTCATCTGTAAAGTGG + Intronic
976225532 4:82792778-82792800 CAGTTTCCTCATCTGTAAAGTGG - Intronic
978198793 4:106000675-106000697 CAGTTTCCTCATCTGTAAAGGGG + Intronic
978297730 4:107226954-107226976 CAGTTTCCTCATGTGTAAAGTGG + Intronic
979392538 4:120143580-120143602 CAGTTTCCTCACCTGTAGAATGG - Intergenic
979597404 4:122549334-122549356 CAGTTTTCTCACTTGTAAAGTGG - Intergenic
979712960 4:123802504-123802526 CAGTTTCCTCACTTGTAAATTGG + Intergenic
980617412 4:135248711-135248733 CAGTTTCCTTACCATTTCAGAGG + Intergenic
982105091 4:152004727-152004749 CAGTTTCCTCATCTGTTCTGGGG + Intergenic
983118488 4:163850263-163850285 CAGATACCTCAGGGGTTCAGAGG - Intronic
983532164 4:168822087-168822109 TAGTTTCCCCATGTGTTCTGCGG - Intronic
983631132 4:169850458-169850480 CACTTTCCTCACTTGTTAAGTGG + Intergenic
984559678 4:181253601-181253623 CAGTTTCCTCATGTGTAGAATGG + Intergenic
984603686 4:181758801-181758823 CTGTTTCCTCCTGTTTTCAGTGG + Intergenic
984962891 4:185114900-185114922 CAGTTTCCTCATGTGTAAAATGG + Intergenic
985172955 4:187172025-187172047 CAGTTTCCTCATCTGTACAATGG - Intergenic
985902751 5:2809477-2809499 CAGTTTCCTCATGTGTAAAATGG - Intergenic
986164345 5:5260692-5260714 CAGTTTTCTCAAGTGTAAAGAGG - Intronic
988615657 5:32772324-32772346 CAGTTTCCTCATCTGTTAAGTGG - Intronic
988997625 5:36729620-36729642 CAGTTTCCCCACCTGTACAATGG + Intergenic
989123208 5:38025607-38025629 CAGTTTCCTCACCTGCACGGTGG + Intergenic
989152642 5:38315721-38315743 CAGTTTCCTCATCTGTACAATGG + Intronic
989546313 5:42678123-42678145 CAGTTTCCTCACCTGTAAAATGG - Intronic
990228265 5:53681292-53681314 CAGTTTACTCACCTGTACAAGGG + Intronic
991288724 5:65009986-65010008 CTGTTTCCTCACCTGTGGAGAGG - Intronic
991501062 5:67278332-67278354 TGGTTTCCTCACCTGTTAAGTGG - Intergenic
992036836 5:72787929-72787951 CAGTTTCCTCATGTGTAAAATGG + Intergenic
992134157 5:73726044-73726066 CAGTTTCCCCCTGTGTTGAGTGG + Intronic
992417662 5:76567191-76567213 CAGTTTCCTCACCTGTGAAGTGG + Intronic
992590606 5:78292573-78292595 CAATTTCCTCACGTGTAAAGTGG + Intronic
992667930 5:79029567-79029589 CAGTTTCCTCATCTGATCATGGG + Intronic
992672001 5:79070058-79070080 CAGTTTCCTCACCTGTGAAATGG - Intronic
992783374 5:80147883-80147905 CAGTTTCCTCAGCTGTACACAGG - Intronic
992800850 5:80294725-80294747 CAGTTTCCTCAAGTGTTGCATGG - Intergenic
993514338 5:88811944-88811966 CAGTTTCCTCACCTGGAAAGTGG + Intronic
993600888 5:89923323-89923345 CATTTTCCTCATCTGTTCAATGG - Intergenic
993852765 5:93031662-93031684 CAGTTTCCTCATCTGTTCAATGG + Intergenic
994123859 5:96148525-96148547 CAGTTTCTTCATCTGTTCAGTGG - Intergenic
994319058 5:98368573-98368595 CAGTTTCCTCATCTTTACAGTGG - Intergenic
994807546 5:104470152-104470174 CAGTTGCCTACAGTGTTCAGTGG - Intergenic
995862058 5:116651404-116651426 CAGTTTCCCCAGGTGTCTAGTGG + Intergenic
997590770 5:135070911-135070933 CAGTTTCCTCACCTATACATAGG - Intronic
997614765 5:135238825-135238847 CAGTTTCCTCATCTGTGCAATGG + Intronic
997779842 5:136645585-136645607 CAGTTTCCTCATGTGTACAATGG - Intergenic
998206419 5:140159831-140159853 CAGCTTCCTCACTTGTACAATGG + Intergenic
998315244 5:141177348-141177370 CAGTTTCCTCATGTGTAAGGTGG + Intergenic
998498449 5:142611369-142611391 CAGTTTCCTCACCTGTGGAATGG - Intronic
998612104 5:143700389-143700411 CAGTTTTCTCATGTGTACAGTGG - Intergenic
998889846 5:146734443-146734465 CAGTTTCCTCACCTGCAAAGTGG - Intronic
998922262 5:147082654-147082676 CAGTTTCCTCCCCTGTAAAGTGG - Intronic
998953387 5:147414084-147414106 CGGTTTCCTCACCTGTTAAATGG + Intronic
999147790 5:149407213-149407235 CAGTTTCCCCATCTGTACAGGGG + Intergenic
999186564 5:149715044-149715066 CAGTTTCCTCATCTGTACAGTGG + Intergenic
999188102 5:149727838-149727860 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
999198386 5:149798773-149798795 CAGTTTCCTCATCTGTAGAGTGG + Intronic
999215473 5:149930569-149930591 CGGGTCCCTCACATGTTCAGGGG - Intronic
999256192 5:150211129-150211151 CTGTTTCCTCCCCTGTCCAGTGG - Intronic
999291118 5:150427183-150427205 CAGTTTCCTCACCTGTAAAATGG + Intergenic
999292043 5:150432207-150432229 CAGTTTCCTCACCTGTAAAATGG + Intergenic
999382595 5:151131890-151131912 CAGTTTCCTCATCTGTTAAGTGG - Intronic
999419007 5:151424795-151424817 CAGTTTCCTCACTTGTAAAATGG - Intergenic
999431026 5:151525562-151525584 CAGTTTCCTCATCTGTAAAGCGG + Intronic
999796361 5:154993158-154993180 CAATTTCCTCACTTGTTAAATGG + Intergenic
1000040526 5:157481488-157481510 CTGTTTCCTCATTTGTACAGAGG - Intronic
1000100841 5:158014774-158014796 CAGTTTCCTCATCTGTTAAATGG - Intergenic
1000112773 5:158125002-158125024 CAGTTTCCTCATCTGCTAAGTGG + Intergenic
1000336030 5:160242177-160242199 CAGTTTCCTCACCTGTAAATGGG + Intergenic
1000382728 5:160643763-160643785 CAATTTCCTCATTTGTACAGTGG - Intronic
1000432699 5:161168850-161168872 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1000967396 5:167674631-167674653 CAATTTCCTCACCTGTCAAGTGG + Intronic
1001227458 5:169957491-169957513 CAGTTTTCTCATCTGTTCAGTGG - Intronic
1001249890 5:170138983-170139005 CAGTTTCCTCACCTGCTAAGTGG + Intergenic
1001425317 5:171618700-171618722 CAGTTTTCTCATCTGCTCAGTGG - Intergenic
1001702663 5:173718600-173718622 CAGTATCCTCACCTGTAAAGTGG - Intergenic
1001717196 5:173825814-173825836 CAGTTTCCCCACGTGTGAAATGG - Intergenic
1001757101 5:174179041-174179063 CAGTTTCCTCATCTGTGCATTGG - Intronic
1001757106 5:174179082-174179104 CAGTTTCCTCATCTGTACATTGG - Intronic
1001804830 5:174574675-174574697 CAGTTTCTTCATGTGTTAAGTGG - Intergenic
1001865064 5:175096722-175096744 CAGTTTCCTAACATGTCAAGAGG + Intergenic
1001953079 5:175829724-175829746 CAGTTTCTTCATTTGTGCAGTGG - Intronic
1002053504 5:176585171-176585193 CAGTTTCCCCATCTGTCCAGTGG + Intronic
1004147440 6:13081260-13081282 CAGTTTCCTCATGCGTGAAGTGG + Intronic
1004412742 6:15396345-15396367 CAGTTTCCTCACCTGTTAAACGG - Intronic
1004456968 6:15800327-15800349 CAGTTTCCTCATCTGTTAAATGG - Intergenic
1004560823 6:16748519-16748541 CAGTTTCCTCGCCTGTGCAATGG + Intronic
1005103882 6:22202668-22202690 CAGTTTTCTCACCTGTTAAATGG + Intergenic
1005309956 6:24549637-24549659 CAGTTTCCTCATGTGTAAAATGG + Intronic
1005705125 6:28443737-28443759 CAGTTTCCTCACCTGTTAAATGG - Intergenic
1006314348 6:33281174-33281196 CAGTTTCCTCACCTCTTAAAGGG - Intronic
1006379729 6:33690524-33690546 CAGTTTCCTCACCTGTAAAATGG + Intronic
1006429961 6:33989281-33989303 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1006436530 6:34028584-34028606 CAGTTTCCTCACGTATAATGTGG + Intronic
1006590257 6:35149913-35149935 CAGTTTCCTCTCCTGTTAAATGG - Intergenic
1006615961 6:35327090-35327112 CAGTTTCCTCACTTGTAAATGGG + Intergenic
1006907534 6:37543028-37543050 CAGTTTCCTCACTGGTACAGTGG - Intergenic
1006908910 6:37551186-37551208 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1006931450 6:37691312-37691334 CAGTTTTCTCATCTGTTCAATGG + Intronic
1007107963 6:39296278-39296300 CAGTTTCCTCACCTGTAAAAGGG - Intergenic
1007252829 6:40507973-40507995 CAGTTTCCTCACCTTTCCACTGG - Intronic
1007283613 6:40731033-40731055 CAGTTTCCTCACCTGTATAATGG - Intergenic
1007519475 6:42440412-42440434 CAGTTTCCTCAAGTGTGAAGTGG + Intronic
1007691384 6:43703716-43703738 CAGTTTCCTCATCTGTACAATGG + Intergenic
1007708799 6:43807911-43807933 CAGTTTCCTCACCTGTCTAGTGG - Intergenic
1007745078 6:44038732-44038754 CAGTTTCCTCATCCGTTCAATGG + Intergenic
1007960268 6:45952521-45952543 CAGTTTCCTCATCTGTACAATGG - Intronic
1008957202 6:57228782-57228804 CAGTTTCCTCACTTGTAAAATGG + Intergenic
1008961085 6:57266822-57266844 CAGTTTCCTCATTTGTGGAGTGG + Intergenic
1010839971 6:80637427-80637449 CAGTTTCCTCCACTGTTAAGTGG - Intergenic
1011836240 6:91434709-91434731 CCGTTGCCTCACATGTTCAACGG - Intergenic
1015139618 6:129914884-129914906 CAGTTTCCTTACCTGTTCATAGG - Intergenic
1015272482 6:131351479-131351501 CAGTTTCCTCTCCTGTATAGTGG + Intergenic
1015472994 6:133627596-133627618 CAGTTTCCTCATCTATTAAGTGG + Intergenic
1015817703 6:137227560-137227582 CAGTTTCCTTACTTGTAAAGTGG + Intergenic
1017075720 6:150615983-150616005 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1017494474 6:154971332-154971354 CAGCTTCCTCATGTGTAAAGGGG - Intronic
1017712271 6:157181407-157181429 CAGTTTCGTCATGTATACAGCGG + Intronic
1018946104 6:168347553-168347575 CAGTTTCCTGATCTGTTCAATGG + Intergenic
1019341013 7:508965-508987 CATTTTCCTCACCTGTGCAATGG - Intronic
1019588370 7:1816639-1816661 TAGTTTCCCCACTTGTGCAGGGG + Intronic
1019643118 7:2115318-2115340 CAGGGTCCCCACGTGTTCCGGGG + Intronic
1019643143 7:2115398-2115420 CAGGGTCCCCACGTGTTCTGGGG + Intronic
1019643166 7:2115476-2115498 CAGGGTCCCCACGTGTTCCGGGG + Intronic
1020500795 7:8917650-8917672 CTGTTTCCTCACGTGTTGAAAGG - Intergenic
1021211050 7:17852953-17852975 CAATTTCCTCAATTTTTCAGTGG + Intronic
1021415201 7:20376115-20376137 CAGTTTCATCACGTGCTTAATGG - Intronic
1021919014 7:25465127-25465149 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1022110789 7:27230078-27230100 CAGTTTCCTCATTTGTAAAGTGG + Intergenic
1022319451 7:29275116-29275138 CAGTTTCCTCACCTGTAAAATGG + Intronic
1022445233 7:30464957-30464979 CAGTTTCCTCATGTGTAAATTGG - Intronic
1022483642 7:30760717-30760739 CAGTTTCCTCACCTGTAAAATGG - Intronic
1023578256 7:41653131-41653153 CAGTTTTCTCACCTGTTGAGTGG - Intergenic
1023771357 7:43559567-43559589 CAGTTTTCTCACTTGTAAAGTGG - Intronic
1023846726 7:44125118-44125140 CAATTTCCTCATGTGTAAAGTGG - Intergenic
1024508754 7:50185774-50185796 CAGTTTCCCCACGTGTAAAATGG + Intergenic
1025234965 7:57228200-57228222 CAGTTTCCTCATCTGTATAGTGG + Intergenic
1025253292 7:57366163-57366185 CAGTTTCCTCATCTGTTAAATGG - Intergenic
1025282515 7:57638590-57638612 CAGTTTCCTCCCCTGTAAAGTGG - Intergenic
1025302210 7:57826820-57826842 CAGTTTCCTCCCCTGTAAAGTGG + Intergenic
1025723072 7:64034029-64034051 CAGTTTCCTCACCTGTATAATGG + Intronic
1025841729 7:65155599-65155621 CAGTTTCCTCATCTGTTAAGTGG + Intergenic
1025881319 7:65540377-65540399 CAGTTTCCTCATCTGTTAAGTGG - Intergenic
1025892120 7:65662238-65662260 CAGTTTCCTCATCTGTTAAGTGG + Intergenic
1026386664 7:69856653-69856675 TAGTTTCCTCAGTTGTGCAGTGG + Intronic
1026402572 7:70030048-70030070 CAGATTACTCACAAGTTCAGTGG + Intronic
1027183622 7:75956508-75956530 CAGTTTCCTCACCTGCTAAATGG + Intronic
1027358020 7:77378649-77378671 CAGTTTTCTTACCTGTTAAGGGG - Intronic
1027406618 7:77868813-77868835 CAGTTTCCTCACGTTTAAAAGGG + Intronic
1027747320 7:82093206-82093228 CAGTTTCCTCACTCGTACAGTGG + Intronic
1029026560 7:97423019-97423041 CAGTTTCCTCATCTGTACAAAGG - Intergenic
1029815812 7:103093651-103093673 GAGTTTCCCCAGGGGTTCAGGGG - Intronic
1029935762 7:104422668-104422690 CAGTTTCCTCATCTGTACAAAGG + Intronic
1030058106 7:105601012-105601034 CAGAATCCCCACGTGTTAAGGGG - Intergenic
1030507567 7:110444138-110444160 CAGTTTCCTCACCTGTAATGTGG + Intergenic
1030654505 7:112151272-112151294 CAGTTTCCTCATGTGTAGAATGG + Intronic
1031055111 7:116984633-116984655 CAGTTTTCTCATTTGTACAGTGG + Intronic
1031967581 7:128038399-128038421 CAGATTCTTCACGTGTAAAGTGG + Intronic
1032196833 7:129794298-129794320 CAGTTTCCCCACCTGTGAAGTGG - Intergenic
1032520429 7:132539636-132539658 CAGTTTCATCATGTGTTAAGTGG + Intronic
1032902340 7:136323851-136323873 CACTTTCCTCATGTGGTCAGAGG + Intergenic
1033154751 7:138947336-138947358 CAGTTTCCTCATTTGTAAAGGGG - Intronic
1034551187 7:151821819-151821841 CAGTTTCCTCATTTGTAAAGTGG + Intronic
1035624531 8:1061031-1061053 CAGTTCCCCCACGTGGGCAGAGG + Intergenic
1036133689 8:6139616-6139638 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1036238563 8:7063623-7063645 AACCTTCCTCACTTGTTCAGAGG - Intergenic
1036674254 8:10816892-10816914 CAGTTTCCTCACTGCTACAGAGG + Intronic
1036688464 8:10926684-10926706 CAGTTTCCCCATGTGTTGAATGG - Intronic
1036813474 8:11884298-11884320 CAGTTTCCTCATCTGTTAAAAGG - Intergenic
1036968287 8:13325637-13325659 CATTTTCCACATGTTTTCAGAGG - Intronic
1037558461 8:20050333-20050355 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1038157793 8:25007202-25007224 CAGTTTCCTCATGTGTCAAATGG - Intergenic
1038310916 8:26445646-26445668 CAGTTTCCTCACCTGCCCACAGG + Intronic
1039799991 8:40945817-40945839 CAGTTTCCTCATGTGTGAAATGG - Intergenic
1040559585 8:48512524-48512546 CTGTTTCTTCACCTGTTAAGTGG + Intergenic
1040981154 8:53247377-53247399 TAGTTTCCTCATCTGTTAAGTGG + Intronic
1040995080 8:53392890-53392912 CAGTTTCCTCATCTGTTAATAGG + Intergenic
1041559378 8:59197357-59197379 CAGTTTCCTGACCTGTAAAGAGG + Intergenic
1042378118 8:68079452-68079474 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1042482147 8:69316162-69316184 CACTTTCCTCCCTTGTACAGAGG + Intergenic
1042558003 8:70050094-70050116 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1042579080 8:70256717-70256739 CAGTTTCCTCATGTGTAAATTGG - Intronic
1043524194 8:81078791-81078813 CAGTTTCCTCATGTGTAAAATGG - Intronic
1043662619 8:82763519-82763541 CAGTTTTCTCACTTGTACAAGGG - Intergenic
1043773828 8:84239512-84239534 CAGTTTCCTCATCTGTACAATGG - Intronic
1044222408 8:89684789-89684811 CATTTGTCTCACGTGATCAGAGG - Intergenic
1044400398 8:91764192-91764214 CAGTTTCCTCAAGTGTAAAATGG - Intergenic
1045025349 8:98081571-98081593 CAGTTTCATCACCTGTAAAGTGG - Intronic
1045153626 8:99439021-99439043 CAGTTTCCTCATCTGTTAATGGG - Intronic
1045760047 8:105594602-105594624 CAGTTTTCTCATGTGTTAAATGG - Intronic
1046748294 8:117899514-117899536 CAGCTTGCTAACGTGTTCACAGG + Intronic
1046782065 8:118226172-118226194 CAGTGTCCTCATGTGTTAAATGG - Intronic
1047198722 8:122745463-122745485 CAGTTTCCTCAGTTGTTAATTGG + Intergenic
1047199717 8:122754960-122754982 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1047295200 8:123564654-123564676 CAGTTTCATCACCTGTGAAGTGG + Intergenic
1047364911 8:124202866-124202888 CAGTTTCCTCACATGTAAATGGG - Intergenic
1047489306 8:125361548-125361570 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1047755085 8:127912357-127912379 CAGTTTCCTCATCTGTAGAGTGG - Intergenic
1047785529 8:128150720-128150742 CATTTCCCCCACGTGTTCACGGG + Intergenic
1047797480 8:128272890-128272912 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1047821385 8:128525128-128525150 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1048051270 8:130819108-130819130 CAGTTTCCTCACCTGTAAAATGG - Intronic
1048197523 8:132344544-132344566 CAGTTTCCTCATCTGCACAGTGG - Intronic
1048310565 8:133319508-133319530 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1048321751 8:133405590-133405612 CAGTTTCCTCACCTGTTCATGGG - Intergenic
1048363969 8:133722175-133722197 CAGTTTCCTCCCGTGTAAACTGG + Intergenic
1048370770 8:133774177-133774199 CAGTTTCCTCATCTGTGCAGTGG - Intergenic
1048436984 8:134427333-134427355 CAGTTTCCTCACCTGTAGAGTGG - Intergenic
1049108678 8:140629444-140629466 CAGTTTTCTCGCCTGTTAAGTGG - Intronic
1049197009 8:141321173-141321195 CAGTTTCCTCATCTGAGCAGAGG - Intergenic
1049197694 8:141324651-141324673 CAGTCTCCTCACCTGTATAGTGG + Intergenic
1049205435 8:141361429-141361451 CAGTTTCCTCATCTGTAGAGTGG + Intronic
1049411268 8:142475024-142475046 CAGTTTCCTCATGGGCTCAGCGG - Intronic
1049420090 8:142512651-142512673 CAGTTTCCTCACCTGTAAAAGGG + Intronic
1049422453 8:142523001-142523023 CAGTTTCCCCATCTGTTCGGTGG + Intronic
1049444330 8:142623126-142623148 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1050090198 9:2010719-2010741 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1051191722 9:14519755-14519777 CAGTTTCCTCAGCTGTTTTGTGG - Intergenic
1051263571 9:15289100-15289122 CAGTTTCCTCACTTATACAGTGG - Intronic
1051538604 9:18188914-18188936 CAGTTTCCTCACTAGTTGAATGG - Intergenic
1051740814 9:20250184-20250206 AAGTTTCCTCACCTGCTAAGTGG - Intergenic
1053190757 9:36064991-36065013 CAGTTTCCTCATCTGTAGAGGGG + Intronic
1053208620 9:36208879-36208901 CAGTTACCTCATCTGTACAGTGG + Intronic
1053419124 9:37965825-37965847 CTGTTTCCTCATCTGTACAGTGG + Intronic
1053887219 9:42652860-42652882 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1053887623 9:42656401-42656423 CAGTTTTCTCATCTGTTCAGTGG - Intergenic
1054226239 9:62460311-62460333 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1054226645 9:62463851-62463873 CAGTTTTCTCATCTGTTCAGTGG - Intergenic
1054406725 9:64769409-64769431 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1054440352 9:65254869-65254891 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1054490055 9:65767069-65767091 CAGTTTCCTCATGTGTGAAATGG - Intergenic
1055142518 9:72892078-72892100 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1055669167 9:78583252-78583274 CTGTTTCCTCAGGTGCTCAAAGG - Intergenic
1055680576 9:78711041-78711063 CAGTCTCCTCCCGTGTTCACTGG + Intergenic
1057046810 9:91892416-91892438 CAGTTTTCTCATTTGTTAAGTGG + Intronic
1057180738 9:93028722-93028744 CAGTTTCCTCACCTGTAAAATGG - Intronic
1057182428 9:93037329-93037351 CAGTTTCCTCAGCTGTCAAGTGG - Intergenic
1057836055 9:98446361-98446383 CAGTTTCCTCATTTGTAGAGTGG - Intronic
1057957415 9:99422426-99422448 CAGTTTCCTCATGTGTAAAATGG - Intergenic
1057964441 9:99489442-99489464 CAGTTTTCTCATCTGTTAAGTGG - Intergenic
1058033538 9:100225478-100225500 CAGTTTCCTCACCTGTAAATTGG + Intronic
1058068174 9:100572779-100572801 CAGTTCCCTGAGGTTTTCAGTGG + Intronic
1058177749 9:101757185-101757207 CAGTTTCCTCATCTGTAAAGTGG - Intergenic
1058477309 9:105350691-105350713 AAGTTTCCTCATGTGTGAAGTGG + Intronic
1058736427 9:107898406-107898428 CAGTTTCCTTATCTGTACAGTGG + Intergenic
1058900867 9:109441028-109441050 CTGTTTCCTTATGTGTTTAGTGG - Intronic
1058985435 9:110205603-110205625 CAGTTTCCTCACCTGTCAATTGG - Intronic
1059078164 9:111217497-111217519 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1059139817 9:111842523-111842545 CAGTTACCACACATTTTCAGTGG - Intergenic
1059367117 9:113794891-113794913 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1059447370 9:114346966-114346988 CAGTTTCCTCATCTGTCAAGTGG + Intronic
1059471763 9:114510319-114510341 TAGTTTCCTCATCTGTACAGTGG - Intergenic
1059472446 9:114516255-114516277 CAGTTTCCTCATCTGTTGAATGG - Intergenic
1059527332 9:115004784-115004806 CAGTTTCATCACTTGTAAAGTGG - Intergenic
1059917954 9:119124741-119124763 CTGTTTCCTCACTTGTAAAGTGG - Intergenic
1060050503 9:120375181-120375203 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1060051774 9:120383278-120383300 GAGTGTCCTCACCTGGTCAGGGG - Intergenic
1060105348 9:120869650-120869672 CAGTTTCCTCAACTGTAAAGTGG - Intronic
1060133047 9:121123713-121123735 CAGTTTTCTCACCTGTAAAGTGG + Intronic
1060139798 9:121200787-121200809 CAGTTTCCTCACTTATGAAGTGG + Intronic
1060155131 9:121314144-121314166 CAGCTTTCTCACGTCTCCAGTGG + Intronic
1060205706 9:121681593-121681615 CAGTTTCCTCACCTGTGAAATGG - Intronic
1060210914 9:121709795-121709817 CAGTTTCCTCACCTGTAAAATGG - Intronic
1060259236 9:122059404-122059426 CAGTTTCCTCATCTGTTAAATGG - Intronic
1060283869 9:122231830-122231852 CAGTTTCCTCATCTGTAAAGTGG + Intergenic
1060470895 9:123947346-123947368 CAGTTTCCTCATCTGTAAAGGGG - Intergenic
1060512635 9:124244984-124245006 CAGTTTCCTCATCTATTAAGTGG + Intergenic
1060525088 9:124315894-124315916 CAGTTTCCTCATCTGTAAAGGGG + Intronic
1060531323 9:124348564-124348586 CAGTTTCCTCACCTATACAATGG + Intronic
1060545062 9:124454630-124454652 CAGTTTCCTCCCTTGTAAAGGGG + Intronic
1060656828 9:125377781-125377803 CAGTTTCCTCATCTGTAAAGCGG + Intergenic
1060735624 9:126064955-126064977 CAGTTTCCTCATCTGCTCAATGG - Intergenic
1060799761 9:126536230-126536252 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1060817678 9:126643912-126643934 CAGTTTCCTCATGTGCAAAGTGG - Intronic
1061008836 9:127943518-127943540 CAGTTTCTTCACCTGTCAAGTGG - Intronic
1061042884 9:128149937-128149959 CAGTTTCCTCATCTGTGCAGGGG - Intronic
1061200779 9:129137351-129137373 CAGTTTCCTCACCTGGACACTGG - Intronic
1061386188 9:130290573-130290595 GAGTTGCCTCACATGTTCGGCGG + Intronic
1061422565 9:130480196-130480218 CAGTTTCCCCACCTGTCCAGTGG + Intronic
1061454204 9:130685400-130685422 CAGGTTCCTCACATGTAAAGTGG + Intergenic
1061556109 9:131370316-131370338 CAGTTTCCTCATTTCTTAAGTGG + Intergenic
1061659424 9:132118859-132118881 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1061873043 9:133530777-133530799 CAGCTTCCTCACCTGTAAAGTGG - Intergenic
1061978727 9:134087624-134087646 CAGTTTCCTCCTGTGTGAAGTGG + Intergenic
1062196891 9:135279390-135279412 CAGCTTCCTCACCTGTAAAGTGG - Intergenic
1062454344 9:136628687-136628709 CAGTTTCCCCACCTGTACAAGGG + Intergenic
1062521097 9:136958322-136958344 CAGTTTCCCCATCTGTGCAGAGG - Intergenic
1202779197 9_KI270717v1_random:19825-19847 CAGTTTCCTCACGTGTGAAATGG + Intergenic
1202797626 9_KI270719v1_random:139127-139149 CAGTTTTCTCACCTGTGCAATGG - Intergenic
1203586257 Un_KI270747v1:6227-6249 CAGTTTCCTCATGTGTGAAATGG + Intergenic
1203617210 Un_KI270749v1:76970-76992 CAGTTTCCTCATGTGTGAAACGG - Intergenic
1186613048 X:11157181-11157203 CAGTTTGCTCACGTGTAAAATGG + Intronic
1186657275 X:11627706-11627728 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1188320177 X:28726733-28726755 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1189031148 X:37452339-37452361 CAGTTTCCTCACTTGTAAAATGG - Intronic
1189173348 X:38930704-38930726 CAGTTTTCTCACCTGTAAAGTGG + Intergenic
1189882629 X:45508117-45508139 CAGTTTCCTCATCTGCTAAGTGG - Intergenic
1190217848 X:48492127-48492149 GAGTATGCTCACGTGTTCAGCGG + Intergenic
1190326100 X:49207865-49207887 CAGTTTCCTCACCTGTTTAAGGG - Intronic
1190340653 X:49292812-49292834 CAGTCTCCTCACCTGTGCAATGG + Intronic
1190627101 X:52346639-52346661 CAGTCTCCTCACCTGTGCAATGG + Intergenic
1192145716 X:68680939-68680961 CAGTTTCCTCACTTGTTAAATGG - Intronic
1192187046 X:68954399-68954421 CAGTTTCCTCAGCTGTTAAATGG + Intergenic
1192202370 X:69074703-69074725 CAGTTTCCTCATCTGTTAAATGG + Intergenic
1192544691 X:72003953-72003975 CAGTTTCCTCATGTGTGAAGTGG - Intergenic
1192676931 X:73207456-73207478 CAGTTTCCTCATCTGTACAAGGG - Intergenic
1192928524 X:75781245-75781267 CAGTTTCCTGTAGTGTTAAGTGG + Intergenic
1193104632 X:77656184-77656206 CAGTTTCCTCATCTGTAAAGTGG - Intronic
1193939403 X:87661913-87661935 CAGTTTCGTCATGTGTAAAGTGG + Intronic
1194981804 X:100449240-100449262 CAGTGTCCTCATCTGTACAGTGG + Intergenic
1195003838 X:100667864-100667886 CAGTTTCCTCACCTATTCAATGG - Intronic
1195286444 X:103389183-103389205 CAGTTTCCTCCCTTGTAAAGTGG - Intergenic
1195478668 X:105317839-105317861 CAGTTTCCTCATTTGTGAAGTGG - Intronic
1196074932 X:111565699-111565721 CAGTTTCTTCACTTGTAAAGTGG - Intergenic
1196086044 X:111683192-111683214 CAGTTTCCTCATGTGTAAAATGG - Intronic
1196123482 X:112075357-112075379 CTGTTTCCTCACCTGTTAAATGG + Intronic
1196378696 X:115065707-115065729 CAGTTTCCTCATGTGTTAAATGG + Intergenic
1196644733 X:118105432-118105454 CAGTTTCCTCATCTGTAAAGTGG + Intronic
1196941602 X:120782184-120782206 CAGTTTCCTCATGTGTAAAATGG + Intergenic
1197140101 X:123108317-123108339 CAGTTTCTTCACCTGTAAAGGGG + Intergenic
1197364323 X:125545108-125545130 CAGGTTCCTCACGTGGTGGGTGG - Intergenic
1197392236 X:125882355-125882377 CAGTTTCCTCATGTGTAAAATGG + Intergenic
1197689248 X:129479020-129479042 CAGTTTCCTCACCTATTAAATGG + Intronic
1198046864 X:132912253-132912275 CAGTTTCCTCTTATGTTCATTGG + Intronic
1198419311 X:136453328-136453350 CAGTTTCCTCATGTGTAAAATGG + Intergenic
1198485679 X:137085257-137085279 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1198517983 X:137427769-137427791 CAGTTTCCACATCTGTTAAGAGG - Intergenic
1198673483 X:139106924-139106946 CGCTTTCCTCATCTGTTCAGTGG - Intronic
1198781901 X:140247003-140247025 CAGTTTCCTCACTTGTTTGATGG + Intergenic
1198803510 X:140471403-140471425 CAGTTTCCTCATCTGTCCAATGG - Intergenic
1199495043 X:148443430-148443452 CTGTTTCCTCACGTGGTGGGAGG + Intergenic
1199519666 X:148721366-148721388 CAGTTTCCTCACATGTGAAATGG + Intronic
1199671506 X:150151901-150151923 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1199681667 X:150228957-150228979 TACTTTCCTCATTTGTTCAGAGG + Intergenic
1201194470 Y:11478131-11478153 CAGTTTCCTCATGTGTGAAATGG + Intergenic