ID: 1128385825

View in Genome Browser
Species Human (GRCh38)
Location 15:67147518-67147540
Sequence CAGTTTCCTCACGTGTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1398
Summary {0: 1, 1: 9, 2: 27, 3: 169, 4: 1192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128385817_1128385825 -5 Left 1128385817 15:67147500-67147522 CCATCCTTTCCTGGGCCCCAGTT 0: 1
1: 0
2: 6
3: 81
4: 604
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192
1128385813_1128385825 8 Left 1128385813 15:67147487-67147509 CCCTGGGTAAATGCCATCCTTTC 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192
1128385814_1128385825 7 Left 1128385814 15:67147488-67147510 CCTGGGTAAATGCCATCCTTTCC 0: 1
1: 0
2: 1
3: 18
4: 170
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192
1128385818_1128385825 -9 Left 1128385818 15:67147504-67147526 CCTTTCCTGGGCCCCAGTTTCCT 0: 1
1: 5
2: 68
3: 448
4: 1894
Right 1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG 0: 1
1: 9
2: 27
3: 169
4: 1192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128385825 Original CRISPR CAGTTTCCTCACGTGTTCAG GGG Intronic