ID: 1128389393

View in Genome Browser
Species Human (GRCh38)
Location 15:67173008-67173030
Sequence CCCCTCGATGGCTATGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128389393_1128389397 -8 Left 1128389393 15:67173008-67173030 CCACAGACATAGCCATCGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1128389397 15:67173023-67173045 TCGAGGGGCTACGGCCTTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 25
1128389393_1128389401 7 Left 1128389393 15:67173008-67173030 CCACAGACATAGCCATCGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1128389401 15:67173038-67173060 CTTGTTGGGATCAATAAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1128389393_1128389399 3 Left 1128389393 15:67173008-67173030 CCACAGACATAGCCATCGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1128389399 15:67173034-67173056 CGGCCTTGTTGGGATCAATAAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1128389393_1128389398 -7 Left 1128389393 15:67173008-67173030 CCACAGACATAGCCATCGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1128389398 15:67173024-67173046 CGAGGGGCTACGGCCTTGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128389393 Original CRISPR CCCCTCGATGGCTATGTCTG TGG (reversed) Intronic
900675283 1:3881397-3881419 CCCCTTAATGGCTATGGCAGGGG + Intronic
902949416 1:19870230-19870252 CCACTCAATGGCCATTTCTGGGG + Intergenic
908174096 1:61537395-61537417 CCCTTCAATGGCTATTTCTGTGG + Intergenic
909361548 1:74765428-74765450 CCCCTAGATGACAATGTCAGTGG + Exonic
912454847 1:109790599-109790621 CCACTCTATTGCTCTGTCTGGGG + Intergenic
922602304 1:226865854-226865876 CCCCCAAATGGCTACGTCTGGGG + Intergenic
923807427 1:237273157-237273179 CTACTAGATGGCTATATCTGGGG + Intronic
1066296509 10:34058575-34058597 GCCCGGGATGGCTTTGTCTGCGG + Intergenic
1067156171 10:43782982-43783004 CCCCTTGCTGGCTGAGTCTGTGG - Intergenic
1071311034 10:84344130-84344152 CTCTTCTATGACTATGTCTGGGG - Intronic
1072503635 10:96043541-96043563 CCCCGCGCTGGCTTTGTATGCGG + Intronic
1072751547 10:97984129-97984151 TCCCTACATGGCTATGTCTGAGG + Intronic
1076786254 10:132751481-132751503 CCCCTCTCTGGCTCTGCCTGCGG + Intronic
1077243281 11:1523128-1523150 GGCCTCGATGACTATATCTGTGG + Intergenic
1078460256 11:11509877-11509899 CCCTTCTTTGGCTATATCTGGGG + Intronic
1084327681 11:68411250-68411272 CCCCTGGAGGGATATGTGTGTGG + Intronic
1088103273 11:106177480-106177502 CCCCTCCACGGCAATGTCTAGGG - Intergenic
1089257767 11:117203006-117203028 ACCCTTGTTGGCCATGTCTGGGG - Exonic
1091154286 11:133359266-133359288 CTCATCAATGTCTATGTCTGTGG + Intronic
1096215327 12:49795205-49795227 CTCCTCGATGGCTGAGTGTGGGG + Exonic
1099368127 12:81795487-81795509 CCCCTCTATGGCTGGATCTGGGG - Intergenic
1102381771 12:112473252-112473274 CCACTAGGTGGCTTTGTCTGTGG + Intronic
1102714536 12:114958823-114958845 CCCCTCATTGGCTCTGACTGTGG - Intergenic
1103991319 12:124801253-124801275 CCACCCGTTGGCTCTGTCTGTGG - Intronic
1113917154 13:113881288-113881310 TCCCTTGCTGGCCATGTCTGAGG + Intergenic
1115872109 14:37816332-37816354 ACCCTCCCTGGCTATGTCAGAGG - Intronic
1117834001 14:59783181-59783203 CCCCTCTATGCCTATGTATATGG + Intronic
1124558027 15:30745921-30745943 CCCCTCGCTGGCCCTCTCTGAGG + Intronic
1128079095 15:64845556-64845578 CCCCTGGGTGGCTGTTTCTGTGG + Intronic
1128389393 15:67173008-67173030 CCCCTCGATGGCTATGTCTGTGG - Intronic
1132567591 16:630546-630568 CCCCTCCATGGCTGTTTCAGGGG - Intronic
1132686389 16:1163889-1163911 CACCTCGAAGGCCAGGTCTGGGG + Intronic
1137710621 16:50564175-50564197 CCCCACCATGGCCATGGCTGCGG - Intronic
1139450553 16:67025463-67025485 CTCATAGAAGGCTATGTCTGGGG - Intergenic
1144718372 17:17450416-17450438 CCCCTTGATGGAAATGGCTGGGG + Intergenic
1151349843 17:73525246-73525268 CCCCTCGAGGGCTGCTTCTGGGG - Intronic
1152723248 17:81933077-81933099 CCCCTCCCTGGCTATGTCCCTGG + Exonic
1156472971 18:37388943-37388965 CCTCTTGATGGCTCTTTCTGAGG + Intronic
1160581943 18:79888104-79888126 ACCCTCGAGGCCTAGGTCTGGGG - Intronic
1161792104 19:6366265-6366287 TGCCTGGATGGCAATGTCTGTGG - Exonic
1162511006 19:11118435-11118457 CCCCACGATGGCTCTATCTAGGG - Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
927653262 2:24924943-24924965 CCCCTCCATGGCTGCATCTGGGG + Intergenic
935677489 2:105608527-105608549 CGCCTGGATGGCCATGTCTGAGG - Intergenic
948857969 2:240739197-240739219 CCCGGCCATGGCAATGTCTGGGG + Intronic
1171002625 20:21430083-21430105 CCCCTCTAAGGCTCTGTCAGGGG - Intergenic
1172801013 20:37576229-37576251 CCCCCAGCTGGCTGTGTCTGGGG + Intergenic
1174137031 20:48386728-48386750 CCCGTCGATGGCTGTGCATGAGG - Intergenic
1174483102 20:50844925-50844947 CCCCACAAGGGCTTTGTCTGGGG + Intronic
1176180793 20:63748436-63748458 CCCATCCCTGGCCATGTCTGAGG - Intronic
1178221225 21:30662264-30662286 CTCCACCATGCCTATGTCTGAGG - Intergenic
1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG + Intergenic
1180207038 21:46267213-46267235 CCCCACGCTGGCCATGGCTGTGG - Intronic
1180756361 22:18164631-18164653 TCCCTGGAAGGATATGTCTGCGG - Intronic
1181075409 22:20372803-20372825 TCCCTGGAAGGATATGTCTGCGG + Intronic
1183032585 22:35116954-35116976 CTCCTCGAAAGCTATGCCTGGGG - Intergenic
1184920368 22:47601253-47601275 CCCCTCCCTGGCTCTGGCTGAGG + Intergenic
1185223293 22:49639847-49639869 CCCCTCCAGGCCTAGGTCTGGGG + Intronic
954113199 3:48447146-48447168 CCCCTTGATGGCTGTGGCTTCGG + Intronic
956466070 3:69521778-69521800 CCCCGCCATGGGAATGTCTGCGG - Intronic
956599878 3:71009240-71009262 ACCCTGGATAGCTATGTCCGGGG + Intronic
960957495 3:123044040-123044062 CCTCTGGATGGCGATGTGTGAGG + Intergenic
961075969 3:123982293-123982315 CTCCTCCATGGTGATGTCTGTGG - Intronic
969115453 4:4868176-4868198 CCCATCTATGTCTATCTCTGGGG - Intergenic
970980331 4:22088981-22089003 CCCTTCTATGGCTATGTTTATGG + Intergenic
971558807 4:28047736-28047758 GCCCTCGATGACTAAGTTTGCGG + Intergenic
980736640 4:136898975-136898997 CCCCTCCATAGCCATGTCTCTGG + Intergenic
999934935 5:156476145-156476167 CCCCTACATGGCTGTTTCTGGGG + Intronic
1004485417 6:16061784-16061806 CCCCTCAATTGCTATGGCTGGGG + Intergenic
1009690936 6:67031233-67031255 CCTCTCAATGGCAATGGCTGAGG - Intergenic
1016324544 6:142885236-142885258 CTCCTCCATGGCTGTGTGTGGGG - Intronic
1029729716 7:102431492-102431514 CCCATCAATGGCTATGGGTGAGG - Intergenic
1032077109 7:128841164-128841186 CCCCTCGATGGAGAAGCCTGGGG - Exonic
1035557401 8:577467-577489 GCCTTCGATGGCTCTGTCTTGGG + Intergenic
1035682979 8:1502123-1502145 CCCATCAGTGGCTCTGTCTGTGG + Intronic
1040779030 8:51084337-51084359 CCCCCCAGTGCCTATGTCTGAGG + Intergenic
1047809959 8:128397624-128397646 CCCCTCAATTGCTATGTCTCTGG - Intergenic
1049273616 8:141708843-141708865 CCCCTCGCTGACTCTGTCTTTGG - Intergenic
1049617857 8:143583689-143583711 CCCCTAGGTGGCTGTGGCTGTGG + Intronic
1051147283 9:14040937-14040959 CCTCTGGATGGCTTTGTCTATGG - Intergenic
1056170351 9:83979740-83979762 TGCCTCGATGGCTTTGTCTCGGG - Intronic
1056319755 9:85425089-85425111 TCCCTCCATGGCTTTTTCTGGGG - Intergenic
1060193183 9:121605898-121605920 CTCCTCGATGTTCATGTCTGTGG - Intronic
1062403503 9:136382737-136382759 CCCATCTCTGGCCATGTCTGTGG - Intronic