ID: 1128389625

View in Genome Browser
Species Human (GRCh38)
Location 15:67174284-67174306
Sequence CTGGAAACACCGATGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128389616_1128389625 24 Left 1128389616 15:67174237-67174259 CCTGTACTTCTGTCTTACCGCCC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389620_1128389625 2 Left 1128389620 15:67174259-67174281 CCATTACCCATCCATAGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389621_1128389625 -4 Left 1128389621 15:67174265-67174287 CCCATCCATAGATCTGACTCTGG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389618_1128389625 4 Left 1128389618 15:67174257-67174279 CCCCATTACCCATCCATAGATCT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389619_1128389625 3 Left 1128389619 15:67174258-67174280 CCCATTACCCATCCATAGATCTG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389624_1128389625 -9 Left 1128389624 15:67174270-67174292 CCATAGATCTGACTCTGGAAACA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389617_1128389625 7 Left 1128389617 15:67174254-67174276 CCGCCCCATTACCCATCCATAGA 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1128389623_1128389625 -5 Left 1128389623 15:67174266-67174288 CCATCCATAGATCTGACTCTGGA 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128389625 Original CRISPR CTGGAAACACCGATGAAGTT TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
902021214 1:13347369-13347391 CCCGAAATACTGATGAAGTTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905574672 1:39034311-39034333 CTGGAAAAACAGATCAATTTTGG - Intronic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
911333867 1:96557410-96557432 CTGGAATCACACGTGAAGTTGGG - Intergenic
916170479 1:161998092-161998114 CTGGAGACACCGAGGTTGTTTGG + Exonic
918394881 1:184103306-184103328 CTGGGAAAAGTGATGAAGTTGGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
923308028 1:232706307-232706329 CTGGAAAAAACAATGAAGCTCGG + Intergenic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1066204689 10:33176652-33176674 CTGGAAACATCCATGAATTTAGG + Intergenic
1067468011 10:46515684-46515706 GTGGAAACCCTGATGAATTTAGG - Intergenic
1077195392 11:1277254-1277276 CTGGAAGCAAAGATCAAGTTTGG + Intronic
1077611410 11:3645287-3645309 CAGGAAACTTTGATGAAGTTTGG + Intronic
1077837764 11:5939103-5939125 CAGGACACACCTATGAAGTATGG + Intergenic
1081910043 11:46694782-46694804 ATGGAAACACCTTTGACGTTCGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086438610 11:86805885-86805907 CTGGGAACACAGCAGAAGTTAGG - Intronic
1088857918 11:113773181-113773203 CTGGAAGCTCCGAGGAAGCTAGG - Intronic
1090277703 11:125431478-125431500 CAGGAAGCACCGAGGGAGTTGGG + Exonic
1090434231 11:126673558-126673580 GTGAAAACACAGATGAATTTTGG - Intronic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1100234072 12:92640093-92640115 CTGCAAACACTGATTATGTTGGG + Intergenic
1102977701 12:117218415-117218437 CTGGAAACACCGCTGCTGCTTGG + Intronic
1104445375 12:128828840-128828862 CTGGGAACAAGGATGAAGTCAGG - Intergenic
1111928208 13:94485330-94485352 TTGGAAACACTGATGATGCTCGG - Intergenic
1119327222 14:73767717-73767739 CTGGAAACTCCCATGAAAGTAGG + Intronic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1126920293 15:53513917-53513939 CTGGAAACACCCATCCAATTTGG - Exonic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134727941 16:16435729-16435751 CTGGACACAATGATGATGTTGGG + Intergenic
1138347045 16:56326506-56326528 CAGGAAGCACCGAGGAAGTGGGG + Intronic
1140507319 16:75482032-75482054 CTGCAAACACCTATGAAGAGGGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150610507 17:66729582-66729604 GTGGAAACACCTGTGAATTTGGG - Intronic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158245470 18:55427512-55427534 TTGGAAACAGGGATGATGTTTGG - Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1160525728 18:79534461-79534483 GTGGAAAAACCGATCAAGTCAGG + Intergenic
1161882670 19:6967702-6967724 CTGCAAACACCTATGAGGTAGGG - Intergenic
1167630848 19:50625565-50625587 CTGGGAACAGCAATGAAGTAAGG + Intronic
924980569 2:216210-216232 CTGGAAACTCCCATGCAGTGTGG - Intergenic
935572472 2:104676538-104676560 CAGGAAACACCTCTGAAGATCGG + Intergenic
940013753 2:149082085-149082107 CTGCAAACATCGAGGAAGTTAGG - Intronic
948587548 2:239028627-239028649 CTGGAGAGAAGGATGAAGTTGGG - Intergenic
1170223261 20:13963777-13963799 CTGGTAACAAGGGTGAAGTTAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183095099 22:35547234-35547256 CTGGAAATAGTGATGAAGTCGGG + Intronic
949576547 3:5343998-5344020 CTGGAAACACTGAGAAAATTGGG - Intergenic
952365199 3:32668182-32668204 TTGGAAACACTGCTGAAATTTGG + Intergenic
955052285 3:55424354-55424376 CTGGAAACACCCATGGGGTGGGG + Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
960608250 3:119530465-119530487 CTGGAAACACAGAACAAGTCTGG + Intronic
962636903 3:137340477-137340499 CAGGAAACACTGAAGAATTTTGG - Intergenic
973329654 4:48900088-48900110 CTGGGAACACTGATGGACTTAGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974662483 4:64910590-64910612 CTGGAATCACAGAATAAGTTAGG + Intergenic
979093611 4:116517892-116517914 CTGGAAAAGCCGCTGAATTTTGG - Intergenic
980674167 4:136052765-136052787 CTTGAAACACCAACGAATTTAGG + Intergenic
982266554 4:153543497-153543519 CTGGAAACGCCTATGAACTGAGG - Intronic
982694911 4:158588712-158588734 AGGAAAACACCAATGAAGTTGGG + Intronic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
992648438 5:78833771-78833793 CTGGGAAAAGGGATGAAGTTGGG + Intronic
993074460 5:83211151-83211173 CTTGAAAAACTGCTGAAGTTTGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
997168619 5:131690312-131690334 CTGGAATAACCGATAAGGTTAGG + Intronic
1000486553 5:161851710-161851732 CTGGAAAGACATATGAATTTAGG + Intronic
1001217927 5:169873325-169873347 TGGGAAACAGCTATGAAGTTTGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1010356283 6:74937639-74937661 GGGGAAACACCTATGAAGTGGGG + Intergenic
1015205137 6:130629082-130629104 CTGGAAACAGTGATGAAATAAGG - Intergenic
1017291258 6:152741115-152741137 CTGGAAACATTGACAAAGTTGGG - Intergenic
1019432214 7:1004378-1004400 CTGGGAACACCCGTGAAGTGGGG - Intronic
1019768152 7:2866427-2866449 CTGGAAATAACGATTAGGTTGGG - Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020684856 7:11281772-11281794 CTGGAAACAGGGATAAAGTGAGG - Intergenic
1022505157 7:30905191-30905213 CTGGGAACACCGAAGAAGCCAGG + Intergenic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026361999 7:69610633-69610655 CTGGAAGCACCGACCAAGTGAGG - Intronic
1027856853 7:83522566-83522588 CAGGAAACACTGGTAAAGTTGGG - Intronic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028035795 7:85980276-85980298 ACGGATATACCGATGAAGTTAGG + Intergenic
1029938729 7:104457005-104457027 ATGGAAACTCTGATTAAGTTAGG + Intronic
1032228446 7:130052814-130052836 CTGGGAACACTGATAGAGTTAGG - Intergenic
1032597565 7:133256841-133256863 CTGGAAATAGCGATGAGATTCGG - Intronic
1033308198 7:140239973-140239995 ATGGAAACACTCCTGAAGTTGGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1047304121 8:123639506-123639528 CTGGACACCCCGATGATGTTTGG + Intergenic
1048458390 8:134599020-134599042 CTGGAAACTCATATGAAGTCGGG - Intronic
1050193427 9:3054456-3054478 GTGGAAACAGCAATGAACTTGGG + Intergenic
1052409407 9:28103881-28103903 CTGGAAACAATGAGGAAGTAGGG + Intronic
1058968138 9:110055934-110055956 CTGGAAAGAGCCATGGAGTTTGG - Intronic
1059870871 9:118574432-118574454 CTGGAAACACCTATTAAACTAGG + Intergenic
1062504304 9:136865583-136865605 CAGGAACCAGCGATGAAGGTGGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188689325 X:33109677-33109699 CTGAAAACAACGACGAAGTGGGG + Intronic
1189687391 X:43579471-43579493 CTGGAAACATAGCAGAAGTTGGG + Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1201265707 Y:12204558-12204580 ATGGAACCACTGATGAAATTTGG + Intergenic