ID: 1128391423

View in Genome Browser
Species Human (GRCh38)
Location 15:67185312-67185334
Sequence CTTCTCTCTACCTGGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 265}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128391423_1128391435 21 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391435 15:67185356-67185378 GATCAGGGAAGTCTTCATGGAGG 0: 1
1: 3
2: 65
3: 388
4: 1306
1128391423_1128391429 -1 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391429 15:67185334-67185356 GGCCCATTTAGCTGTTGGGATGG 0: 1
1: 0
2: 0
3: 6
4: 102
1128391423_1128391427 -6 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391427 15:67185329-67185351 GAGAAGGCCCATTTAGCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 103
1128391423_1128391432 5 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391432 15:67185340-67185362 TTTAGCTGTTGGGATGGATCAGG 0: 1
1: 0
2: 0
3: 16
4: 178
1128391423_1128391428 -5 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391428 15:67185330-67185352 AGAAGGCCCATTTAGCTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1128391423_1128391434 18 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391434 15:67185353-67185375 ATGGATCAGGGAAGTCTTCATGG 0: 1
1: 0
2: 6
3: 66
4: 412
1128391423_1128391433 6 Left 1128391423 15:67185312-67185334 CCAGCAGCCCAGGTAGAGAGAAG 0: 1
1: 0
2: 2
3: 31
4: 265
Right 1128391433 15:67185341-67185363 TTAGCTGTTGGGATGGATCAGGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128391423 Original CRISPR CTTCTCTCTACCTGGGCTGC TGG (reversed) Intronic
900344156 1:2203219-2203241 CTTGGCCCCACCTGGGCTGCAGG - Intronic
901242272 1:7702407-7702429 CTTCTCTTTAACTGGGCTTCAGG + Intronic
901418991 1:9137446-9137468 CTCCTCTTCACCTGGGCAGCTGG - Intergenic
902238110 1:15070586-15070608 CGTCACTCAACCTGGGCTCCTGG + Intronic
902957825 1:19938101-19938123 CTTCTCTCTTCCCTGTCTGCTGG - Intergenic
903541086 1:24096767-24096789 CTTCTCTCTCCCGGGGGTCCTGG + Intronic
904644816 1:31957760-31957782 CTTCTCTCTTCCTTGGTTGCTGG + Intergenic
904838285 1:33353846-33353868 CTTCTCCCTGCCTGGGGTTCAGG - Intronic
904991901 1:34599887-34599909 CTTCTTTCTACCTGGAATGTGGG - Intergenic
905503731 1:38459825-38459847 CTTCCCACTACCTGAGCAGCTGG + Intergenic
908994455 1:70134543-70134565 CTTCCCTCTACCTTTGCTCCGGG - Intronic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
910071512 1:83219912-83219934 TTTCTTTCAACATGGGCTGCTGG - Intergenic
911292835 1:96079114-96079136 CTTTTCTCTGCCTTGACTGCAGG + Intergenic
911494168 1:98610434-98610456 CTTCTCTCTCCTTAGGTTGCAGG + Intergenic
913030885 1:114901842-114901864 CTTTTCTCTACCTTGTCAGCAGG - Intronic
915528268 1:156489247-156489269 CTTCCCTGTGGCTGGGCTGCAGG + Intronic
915718238 1:157964267-157964289 TTCCTCTCTTCCTGGGTTGCAGG + Intergenic
915844237 1:159247082-159247104 CATCTCTCTCCCTGGGTTGAGGG + Intergenic
915893078 1:159789354-159789376 CTTCTCTCTGCCTGTGTTGGTGG + Intergenic
916442689 1:164843007-164843029 CTTCCCTCTACCTCGACTGTGGG - Intronic
916678358 1:167082984-167083006 CTTCTCTCTGCCTGCTCTGTGGG - Intronic
917153199 1:171966294-171966316 CTTCCCTCTCCCTCAGCTGCAGG + Intronic
918285114 1:183045673-183045695 ATTCTCTCTACCTGGGTTGCTGG + Intronic
920100486 1:203514115-203514137 CTTCCCTCTAGCTTGGCGGCGGG + Intergenic
922505660 1:226124018-226124040 CTTCTCCCTTCCTGGGCATCTGG - Intergenic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
922532273 1:226353542-226353564 TTTCTCTCTCCCTGGGCTGGAGG - Intergenic
923037440 1:230294125-230294147 CTTCTTTCTTTCTGGCCTGCAGG - Intergenic
924931953 1:248739969-248739991 CTTCTTCCTGCCTGGGCTTCAGG - Intronic
1062785136 10:258344-258366 CTTCTCTCTCCAGGGGCTCCTGG - Intergenic
1063473751 10:6310111-6310133 CTCCTGTCTGCCTGGGCTGATGG - Intergenic
1063649062 10:7915281-7915303 CTTTGCTCTTCCTGTGCTGCCGG + Intronic
1064526563 10:16262760-16262782 TTTCTTTCTACCTGGGCAGTGGG - Intergenic
1065530768 10:26668006-26668028 CTCCTCTCCACTTAGGCTGCAGG - Intergenic
1067213622 10:44282015-44282037 CTGCTCTCTACCTGAGTTTCTGG - Intergenic
1067231117 10:44411451-44411473 CTGATATCTACCTGGGATGCTGG - Intergenic
1067448894 10:46369200-46369222 CTCCTTTCTACCTGGGCTGGGGG + Intronic
1067588479 10:47491565-47491587 CTCCTTTCTACCTGGGCTGGGGG - Intronic
1067635605 10:47999656-47999678 CTCCTTTCTACCTGGGCTGGGGG - Intergenic
1067877918 10:50020739-50020761 CTCCTTTCTACCTGGGCTGGGGG + Intergenic
1068580613 10:58735282-58735304 CTTCTCGCAGCCTGTGCTGCTGG + Intronic
1070132163 10:73663663-73663685 CTCCTTTCTACCTGGGCTGGGGG - Intronic
1071609518 10:87020412-87020434 CTCCTTTCTACCTGGGCTGGGGG + Intronic
1072237595 10:93466569-93466591 CTGCTCACTGCCAGGGCTGCTGG + Intronic
1075619638 10:123916300-123916322 CTTCTCTATCCCAGGGCTCCTGG - Intronic
1079164665 11:18028642-18028664 CTTTCCTCTACCTTGGCTGCAGG + Intronic
1080693155 11:34576452-34576474 CTGCTCTCTTCCTGGAATGCTGG + Intergenic
1081904545 11:46659474-46659496 CTTCCCCCTACCTGGGATGGTGG - Exonic
1085179405 11:74520994-74521016 TTTCTCTCCACCTGGGTTCCAGG + Intronic
1086870756 11:92033842-92033864 CTTCCCTCTCCCTGCCCTGCAGG + Intergenic
1087068344 11:94048767-94048789 CTTCTCTCTATCCTGTCTGCAGG + Intronic
1087175248 11:95089963-95089985 CTTCGCCCTGGCTGGGCTGCTGG + Exonic
1089385011 11:118061679-118061701 CTTCCTGCGACCTGGGCTGCTGG + Intergenic
1089556697 11:119319201-119319223 CTTCTCTCCCCTGGGGCTGCCGG - Intronic
1090354100 11:126128029-126128051 CCTCTCTCCACCTGAGCTGTGGG + Intergenic
1090441988 11:126731960-126731982 CTTCTCTCTCTCTTTGCTGCTGG - Intronic
1092525295 12:9306101-9306123 CTTCAGTCGTCCTGGGCTGCAGG - Intergenic
1092541977 12:9425716-9425738 CTTCAGTCGTCCTGGGCTGCAGG + Intergenic
1093798281 12:23340123-23340145 CTTTTCTCCCCCTGGGCTTCAGG + Intergenic
1094252726 12:28383590-28383612 CTTCTGCCTGGCTGGGCTGCGGG + Intronic
1094511033 12:31096723-31096745 CTTCAGTCGTCCTGGGCTGCAGG - Exonic
1095139751 12:38647039-38647061 CTTCTCTCTACCTGCTCTCAGGG - Intronic
1095954542 12:47798665-47798687 CTTGTCCCTTTCTGGGCTGCCGG - Intronic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096748599 12:53744592-53744614 ATTCTCTCCACTTGGGCTCCAGG + Intergenic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1097173363 12:57129255-57129277 CTTCTCTCTACCCAGGCCTCTGG - Intronic
1097233137 12:57524007-57524029 CATCTCTCTACTTGCGTTGCAGG + Exonic
1098190073 12:67938612-67938634 CTACTCTCACCCTTGGCTGCTGG - Intergenic
1099865212 12:88271606-88271628 CTATGCTCTACCTGGGCTGGTGG + Intergenic
1100676959 12:96878668-96878690 CTTCTCTCTCCTTGGGTTGGGGG - Intergenic
1102144730 12:110646173-110646195 CCTGCCTCTACCTGGGTTGCCGG - Intronic
1102254899 12:111409787-111409809 CATCCCTCTACCAGGGCTCCAGG + Intronic
1102755445 12:115335782-115335804 CTTCCCTCCTTCTGGGCTGCTGG - Intergenic
1103706845 12:122879497-122879519 CTTCTCACTTCCAGGCCTGCGGG - Intronic
1105946647 13:25196113-25196135 GTTCTCTACACCTGGGCTCCAGG + Intergenic
1112433584 13:99374488-99374510 ATTCTCTCTACTTGGGCTAATGG - Intronic
1114916097 14:27267231-27267253 CTTCTCTCTACTTTGGCTTTGGG - Intergenic
1118765938 14:68909393-68909415 CTTCTCTCTCCCCGGGCAGCTGG - Exonic
1119910638 14:78346349-78346371 CTCCTCCCTACCTGGTCTCCTGG + Intronic
1121731861 14:96192941-96192963 CTTTTCTGCACCTGGGGTGCAGG + Intergenic
1122463556 14:101915957-101915979 CTTTTCTCTACCTCTGCCGCGGG - Intronic
1122506152 14:102233174-102233196 CTTCTCCCTCCCTGGGATGTGGG + Intronic
1122655718 14:103258257-103258279 CTTCTCTGTCCCTGGGCTCCTGG + Intergenic
1122808917 14:104278112-104278134 ATTCTTTCTCCCTCGGCTGCGGG + Intergenic
1122994393 14:105254994-105255016 CATCTCTCTTCCTGGGCAGCAGG + Intronic
1124222974 15:27865777-27865799 CTTCTCTCTACATCAGCAGCAGG + Intronic
1126775066 15:52093537-52093559 CTTCCCTCTCTTTGGGCTGCTGG + Intergenic
1127827348 15:62716360-62716382 CTTCTCTCAGCCTTTGCTGCTGG - Exonic
1128029410 15:64466497-64466519 CTTCACTCCACTTGGGCTGTGGG - Intronic
1128391423 15:67185312-67185334 CTTCTCTCTACCTGGGCTGCTGG - Intronic
1129164715 15:73770039-73770061 CTGCTGTCTGCCAGGGCTGCTGG + Intergenic
1129188629 15:73925193-73925215 CTCCTCTCTAGGTGGGCTCCAGG + Intergenic
1129750843 15:78062397-78062419 CTTCACTCTTCCTGGACTGTGGG + Intronic
1132372366 15:101307682-101307704 CTTCTCTCTCCAGCGGCTGCCGG + Intronic
1132602139 16:778157-778179 CTTCTCCCTGCACGGGCTGCAGG - Intronic
1132605422 16:791829-791851 CCTTCATCTACCTGGGCTGCAGG + Exonic
1134043874 16:11087386-11087408 CTTCACTCTCCCTGTGCTGTAGG - Intronic
1134740850 16:16542891-16542913 CTGATCTCTACCAGGGATGCAGG - Intergenic
1134926654 16:18169293-18169315 CTGATCTCTACCAGGGATGCAGG + Intergenic
1136099276 16:27981465-27981487 CCTCTCACTATCTGGGCTGGCGG + Intronic
1137669243 16:50269743-50269765 CTGCTCTCTCCCTGGGCAGTGGG - Intronic
1138533066 16:57645590-57645612 CATCTCTAAACCAGGGCTGCTGG + Intronic
1138815487 16:60198600-60198622 GTTCTCTATTCCTGGGCTTCTGG - Intergenic
1139168685 16:64603287-64603309 CTTCACTCTACCTTTGCTGGTGG - Intergenic
1139392367 16:66612949-66612971 CTTGTCTGTATCTGGGCAGCAGG + Exonic
1142603433 17:1068718-1068740 CTTCTCTCTACCCGGGAGGGTGG - Intronic
1143421033 17:6792480-6792502 CTTATGTCTACCTGGATTGCTGG + Intronic
1143856691 17:9856351-9856373 CTTCTCTCTAACTAGACTGGGGG - Intronic
1145258090 17:21338538-21338560 CTTCTGTGTTCCTGGGATGCTGG + Intergenic
1145960847 17:28885799-28885821 CTTCTCTCTTCCTGCCCTGCGGG - Intronic
1146820959 17:35983503-35983525 CTTCTCACTACCTGCATTGCAGG + Intronic
1148588005 17:48794580-48794602 CTCCTCCCCACCTGGGCTGTGGG - Intronic
1148664281 17:49362506-49362528 CTCGTCTTTACCTGGGCTCCCGG - Intergenic
1148838857 17:50482040-50482062 CTTGTCTCTCTCTGAGCTGCTGG + Intronic
1149551495 17:57543489-57543511 CCTCTCTCTACCTGGCCTCTGGG - Intronic
1149596049 17:57865349-57865371 CTCCTCTCTGCCTGGGCAGCTGG - Intronic
1152109818 17:78351769-78351791 CTTCCCTCTCCCTGAGCTGGAGG - Intergenic
1152276538 17:79361260-79361282 CTTCCCTCTCCCCAGGCTGCTGG + Intronic
1152660961 17:81541712-81541734 CTTCTCCCATCCTGGGCTTCAGG + Intronic
1152676139 17:81642336-81642358 CTCCTCTGTGGCTGGGCTGCTGG - Exonic
1152676746 17:81645213-81645235 CTTCTCCCTGCTGGGGCTGCTGG + Exonic
1152727078 17:81952768-81952790 CTTGTCTCTGGCTGGGCTGTGGG + Exonic
1154059540 18:11046814-11046836 CTTCTCTATAGCCTGGCTGCCGG - Intronic
1154165221 18:12009606-12009628 CATTTCTCTGCCTGGCCTGCTGG + Intronic
1157500924 18:48190103-48190125 CTTCTCTCTGCCTTGGGTGCGGG + Intronic
1157898538 18:51491329-51491351 ATTCTCTCTACTTGGGATACAGG + Intergenic
1158326452 18:56318589-56318611 CTTCTCTATAAGTGGGCTCCAGG + Intergenic
1159536100 18:69717150-69717172 AATCTCTCCACCTGTGCTGCAGG - Intronic
1161579563 19:5073368-5073390 CTGCTCCCCACCGGGGCTGCTGG - Intronic
1162660166 19:12162807-12162829 CTTCACTGTACTTGGTCTGCGGG - Intergenic
1163004400 19:14388575-14388597 CCTCTCTTTCCCTGGGCTGAAGG - Intronic
1163063063 19:14774159-14774181 CCTCTCTTTCCCTGGGCTGAAGG + Intronic
1163175789 19:15563492-15563514 CTCCTCCCTGCCTGGGCAGCTGG - Intergenic
1163692057 19:18743513-18743535 CTTCCCTGTCCCTGGTCTGCGGG + Intronic
1165422985 19:35731657-35731679 CTCCTCTCTGCCTCTGCTGCAGG - Intronic
1167751850 19:51385591-51385613 CTTATCTCTGCCAGGGATGCAGG - Intronic
1167788734 19:51657683-51657705 CTTCTCCCTACCAGGGCTATGGG - Intergenic
1168300513 19:55402177-55402199 CTTCTCTCTGTCCAGGCTGCAGG - Intronic
925023054 2:587218-587240 CTTCTCCCTACCTGAGCTCCTGG - Intergenic
925535958 2:4916928-4916950 CTTCTATGTGCCTGGGTTGCAGG - Intergenic
926135435 2:10332542-10332564 GTACTCCCTAGCTGGGCTGCAGG + Intronic
926775490 2:16418336-16418358 CTTCTGTCTACACTGGCTGCTGG - Intergenic
927869804 2:26616284-26616306 CTTCGCTCACCCAGGGCTGCAGG - Intronic
928202819 2:29261531-29261553 CATTTCTCTTCCTGGGCTGCAGG + Intronic
928419266 2:31124890-31124912 CTTCTTTCTACGTGGACTCCTGG + Intronic
930045908 2:47172790-47172812 GTTCTCTCTACATGGGTTGGGGG + Intronic
932127299 2:69155776-69155798 CCACCCCCTACCTGGGCTGCAGG - Intronic
932493287 2:72134533-72134555 CTTCTCTCCCCATGGCCTGCAGG - Intronic
932862039 2:75304544-75304566 CATCTGTCTACCTGGCCTCCTGG - Intergenic
933975638 2:87507068-87507090 CTTCTCTTTAGCTGGGGTGGTGG + Intergenic
935014647 2:99169124-99169146 CTTCTCTGTTACTTGGCTGCGGG - Intronic
936318186 2:111443745-111443767 CTTCTCTTTAGCTGGGGTGGTGG - Intergenic
940160094 2:150702490-150702512 GTCCACTCTACATGGGCTGCTGG - Intergenic
941005583 2:160243849-160243871 TTTCCCTCTTCCTGGGCAGCAGG - Intronic
944501473 2:200364712-200364734 CTCCTTTCTGCCTGGACTGCAGG + Intronic
945957807 2:216102307-216102329 CTTGTGTCTACCTGGCCTGTAGG + Exonic
946215463 2:218180107-218180129 CTTCTTGTTACTTGGGCTGCAGG + Intergenic
946978377 2:225178307-225178329 CTTTGCTCTAACAGGGCTGCAGG - Intergenic
947505725 2:230707141-230707163 CTCCTCACTTCCAGGGCTGCAGG + Intergenic
947938029 2:234024535-234024557 CTCCTCACTGCCTGGGCCGCAGG + Intergenic
948029436 2:234804987-234805009 CTTCTCTCATTCAGGGCTGCTGG + Intergenic
948795106 2:240398714-240398736 CCCCTCCCTCCCTGGGCTGCTGG + Intergenic
948869490 2:240791164-240791186 CTTCTCTCTGCCTCTGCTCCTGG - Intronic
1170618209 20:17971667-17971689 CTTCTCTCTGCCTGGGCTATTGG - Intronic
1170668961 20:18412641-18412663 CTTACCTCTTCCTGGGCTGATGG + Exonic
1171195418 20:23193912-23193934 CTTGTCCCTCCCTGGGCTGTTGG + Intergenic
1172889385 20:38253155-38253177 CTTCTCTGACCTTGGGCTGCAGG - Intronic
1174229773 20:49036958-49036980 CTGCTCTCAGCCTGGGCTACAGG - Intergenic
1174765417 20:53249192-53249214 CATCTATCTACATGGGCTGAGGG + Intronic
1176834321 21:13778199-13778221 CTTCTCACTACCTGGGTGACAGG + Intergenic
1178245031 21:30942402-30942424 CCTCTCTCTACCTGGCATTCAGG + Intergenic
1178775830 21:35549529-35549551 ATTCCATCTACCTGGGCTGATGG + Intronic
1180149850 21:45941872-45941894 CTGCTCTCTACAGAGGCTGCAGG + Exonic
1180758142 22:18177599-18177621 CTTTTCTCTACCAGGGAGGCAGG + Intergenic
1180768430 22:18361391-18361413 CTTTTCTCTACCAGGGAGGCAGG + Intergenic
1180777880 22:18501000-18501022 CTTTTCTCTACCAGGGAGGCAGG - Intergenic
1180810605 22:18758311-18758333 CTTTTCTCTACCAGGGAGGCAGG - Intergenic
1180826307 22:18864615-18864637 CTTTTCTCTACCAGGGAGGCAGG + Intergenic
1181196751 22:21192566-21192588 CTTTTCTCTACCAGGGAGGCAGG - Intergenic
1181212776 22:21300558-21300580 CTTTTCTCTACCAGGGAGGCAGG + Intergenic
1182486792 22:30643934-30643956 CTGCCCTTTCCCTGGGCTGCAGG + Intronic
1183211777 22:36455538-36455560 CTTCACCCCACCTGGGCCGCAGG + Intergenic
1183940307 22:41290917-41290939 CATCTCTCTCCAGGGGCTGCAGG - Intergenic
1183945435 22:41323256-41323278 CATCTCTCTTCATGGGCGGCAGG + Intronic
1184176805 22:42793544-42793566 CGTCTGTCCACCTGGGCTGCGGG - Intergenic
1184643495 22:45884312-45884334 CTGCTCTCGACTTGGGCTTCAGG - Intergenic
1184724550 22:46335930-46335952 CTCCTCCCTCCCTGGGCCGCTGG + Intronic
1184864750 22:47195884-47195906 CTGCCCTCCCCCTGGGCTGCAGG + Intergenic
1184951068 22:47842916-47842938 CTACTCTCTACCTTGGCTCCTGG + Intergenic
1184994414 22:48194935-48194957 CTTCCCTCTGCCTGGGCTGACGG + Intergenic
1203230048 22_KI270731v1_random:102279-102301 CTTTTCTCTACCAGGGAGGCAGG + Intergenic
1203276448 22_KI270734v1_random:90521-90543 CTTTTCTCTACCAGGGAGGCAGG + Intergenic
949615406 3:5748369-5748391 CTTCTATCTTCCTGGGGTGAGGG + Intergenic
950643314 3:14362214-14362236 CAGCGCTCTCCCTGGGCTGCAGG - Intergenic
950960469 3:17100406-17100428 CTGTTCTCTACCTTGGCTGAAGG - Intergenic
951694676 3:25433881-25433903 GTTCTCTCTACCTAGGAAGCAGG + Intronic
951844774 3:27073492-27073514 CTTCTCCTTTCCTGGTCTGCTGG - Intergenic
953913959 3:46906311-46906333 CTTCTCGCAGCCTGGGCTGAGGG - Intergenic
954111483 3:48435989-48436011 CTTCTCATTACCTGGACAGCAGG + Intronic
954671613 3:52294134-52294156 CCTCTCTCAACCCAGGCTGCTGG - Intergenic
954716630 3:52530062-52530084 CCTCACTCTCCCTGGGCTGTGGG - Intronic
955239066 3:57164306-57164328 CTGCTCCCTACCTGGGCTTCTGG - Intronic
955324571 3:58000292-58000314 CTGATCTCCACCTTGGCTGCTGG + Intergenic
957963175 3:87287028-87287050 CTTATCTCTGCCTGGGCTGCTGG + Intergenic
958829998 3:99074857-99074879 ATTATCTCCACCTGGGCTTCTGG + Intergenic
959784811 3:110283245-110283267 CTTCCCTCTACCCCTGCTGCAGG + Intergenic
959896357 3:111611239-111611261 GTTATGTCTACCTGGGGTGCTGG - Intronic
961768911 3:129233813-129233835 CTTCTCTTTTCCTCGGCTTCCGG - Intergenic
961920097 3:130416611-130416633 CTTCTCTCCTCCTGGGTGGCTGG + Intronic
962422380 3:135239966-135239988 CCTCTTTCTACCTGTGCGGCGGG - Intronic
964450126 3:156804295-156804317 CTTATCTACACCTGGGCAGCAGG - Intergenic
967233215 3:187360523-187360545 CTTCTCATTTCCTGGGCTCCTGG + Intergenic
968909986 4:3472784-3472806 CTAGTCTCTTCCTCGGCTGCTGG - Intronic
969599566 4:8167992-8168014 CCTCTCTCTGCTGGGGCTGCTGG - Intergenic
972458451 4:39276713-39276735 CTTCTCTCTTCCTGTGCTACTGG - Intronic
976326765 4:83780324-83780346 CTTCTGTCTACAGGGACTGCTGG + Intergenic
977902364 4:102437292-102437314 CCTCTCTTTGCCTGGACTGCAGG + Intergenic
987416115 5:17663509-17663531 CTTCCCTCCACCGGGGGTGCGGG + Intergenic
988697824 5:33641763-33641785 CTTCTCTCCACATGTGCTGGGGG - Intronic
992398119 5:76386443-76386465 TTTCTCCCTTTCTGGGCTGCAGG + Intergenic
995858915 5:116621505-116621527 ATGCTCACTACCTGGGCTTCTGG - Intergenic
996595252 5:125193816-125193838 CTTCTCTGTACATGGCCTGATGG - Intergenic
997818071 5:137036956-137036978 TCTCTCTCTCCCAGGGCTGCCGG - Intronic
1002416848 5:179125258-179125280 TCGCTGTCTACCTGGGCTGCAGG - Intronic
1004357995 6:14946772-14946794 CCTCCCTCTCCCTGGGCTGTAGG - Intergenic
1006728738 6:36219150-36219172 ATTCAGTCTACCTGGGCTGTAGG + Intronic
1006932007 6:37694221-37694243 CTTCTCTCTTCTAGGGCTGCAGG + Intronic
1007450661 6:41938929-41938951 CTTCCCTCTGCCTGAGCTGGGGG - Intronic
1007655149 6:43447234-43447256 CTTCTCTCCCCCAGGGCTGGTGG + Exonic
1007949820 6:45861318-45861340 GTTCTCTGTGCCTGAGCTGCTGG + Intergenic
1015642755 6:135354166-135354188 GTTCTCTCTACCGGGGTTACAGG + Intronic
1016689619 6:146922033-146922055 CGACCCTCTTCCTGGGCTGCAGG - Intergenic
1016998282 6:149976517-149976539 CTTCTCTCTGCCTTCCCTGCGGG + Intergenic
1019014596 6:168870836-168870858 CTGCTCTCTGCCTGGGCTACTGG + Intergenic
1019018407 6:168897239-168897261 TTCATCTCTAGCTGGGCTGCTGG + Intergenic
1019346209 7:531964-531986 CTGCTCTCTGCGTGGGCTGAGGG - Intergenic
1022333193 7:29399260-29399282 CTTCCTTCAACATGGGCTGCTGG - Intronic
1023866317 7:44240108-44240130 CTTGTCCAGACCTGGGCTGCCGG + Intronic
1026501802 7:70948985-70949007 TCTCCCTCTTCCTGGGCTGCAGG - Intergenic
1027226318 7:76246080-76246102 CTCTGCTCTCCCTGGGCTGCAGG - Intronic
1030921867 7:115400748-115400770 CTTCTCTCTGCATGTGCTGTGGG - Intergenic
1031974461 7:128085034-128085056 CTTCTGTCTGGCTGGACTGCAGG - Intronic
1034276311 7:149825380-149825402 CTGCTGGCTACCTGGGCGGCAGG - Intergenic
1034471811 7:151258752-151258774 CTTCTCTCTGCCCTGGCTTCTGG + Intronic
1035653809 8:1290087-1290109 TTTATTCCTACCTGGGCTGCAGG + Intergenic
1036088488 8:5638890-5638912 TTTCTGTTTGCCTGGGCTGCAGG + Intergenic
1036382281 8:8244407-8244429 ATTGTCTCTACCTGGGCAGGGGG + Intergenic
1037785086 8:21897986-21898008 CTTCACTCTTCCTGGGAAGCTGG - Intergenic
1038351145 8:26777411-26777433 GTCCTCTCTACCTGGGATCCAGG - Intronic
1041687916 8:60661127-60661149 CTTCCCTCTTCCTTGGCTGAGGG + Intergenic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1043103873 8:76083216-76083238 CAGTTCTCTACCTGGGCTACAGG + Intergenic
1043912169 8:85875697-85875719 CTTCCCACTACCTGGGATGGTGG + Intergenic
1044942839 8:97360735-97360757 CTCATCTCTACCTGGGCTTCTGG + Intergenic
1045694200 8:104789302-104789324 CTTCTCTCCACCTGTCCAGCTGG + Intronic
1046767382 8:118084422-118084444 CATCTCTTTCACTGGGCTGCAGG + Intronic
1046944887 8:119965256-119965278 CTTCCTCCTCCCTGGGCTGCAGG - Exonic
1047712942 8:127570059-127570081 CTTCTTTCTCCCAGAGCTGCTGG + Intergenic
1048503183 8:134997118-134997140 CTTCTCCCCACATGGCCTGCAGG - Intergenic
1049341447 8:142114760-142114782 GTTCTCTCTGCTTGGGCTTCCGG - Intergenic
1049519458 8:143080637-143080659 CTTCTCTCCTGCCGGGCTGCAGG - Exonic
1051481042 9:17561799-17561821 CTTCTCAGTACCTGGGATACAGG + Intergenic
1052380765 9:27768305-27768327 CTGCTCTATAAATGGGCTGCAGG - Intergenic
1052723391 9:32200256-32200278 TTTCTCTATTCCTGGGCTGGAGG + Intergenic
1052769841 9:32677524-32677546 CTTCTTTTTATCTGGGCTTCTGG + Intergenic
1053143747 9:35698165-35698187 TTTCTCTCTGCCCAGGCTGCTGG - Exonic
1053294395 9:36902576-36902598 CCCCTCTCCACCTGGGCTTCAGG - Intronic
1055021532 9:71675473-71675495 CTGCTTTCTGCCTGGGCTCCAGG - Intergenic
1055728523 9:79257489-79257511 CCTTTCTCTCCCGGGGCTGCGGG - Intergenic
1056104624 9:83334735-83334757 TTACACTCTACATGGGCTGCTGG - Intronic
1056678381 9:88696210-88696232 CTTCTCTGTAGCTGGGCTGGTGG + Intergenic
1056795937 9:89659047-89659069 CCTCACGCTACCTGGGCAGCAGG - Intergenic
1057631178 9:96720074-96720096 CTTTTCTCTGGTTGGGCTGCAGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1059123472 9:111662160-111662182 CTCCTCTCTACCTCGGCGGGTGG - Intronic
1059348326 9:113647300-113647322 CTTCTCCCTAGCAGGCCTGCTGG + Intergenic
1060488602 9:124065461-124065483 CTGAACTCCACCTGGGCTGCAGG - Intergenic
1061297529 9:129685060-129685082 CTGCCCTCTCCCTGGGCTGAGGG + Intronic
1061919367 9:133774315-133774337 CTTCTGTGTGCCTGGCCTGCAGG - Intronic
1062424572 9:136500181-136500203 CCTCCCTCAACCTTGGCTGCCGG - Intronic
1186623229 X:11263677-11263699 CCAGTCTCTGCCTGGGCTGCTGG - Intronic
1189162082 X:38819744-38819766 TTTCTTTCTACCTGTTCTGCTGG - Intergenic
1189680090 X:43506844-43506866 ATTCACTCTCCCTGGGGTGCAGG - Intergenic
1189699244 X:43699801-43699823 CTGCTTTCTACATGGCCTGCTGG - Intronic
1190620891 X:52285550-52285572 CTTCTCTCTCACTTGGCTCCTGG - Intergenic
1192366859 X:70480844-70480866 GTTCTCTCTGCCTGGGCAGGGGG + Intronic
1196378987 X:115068917-115068939 CTTCTCTCTCTCAGGGCCGCTGG - Intergenic
1197251207 X:124218003-124218025 CTTCTGTCTTCCGGGGCTGGGGG + Intronic
1197452545 X:126637961-126637983 CTTCTCTCTCACTGGGGTGGAGG - Intergenic
1198101393 X:133425203-133425225 CTTCACTCTCCCAGGGCTCCAGG + Intergenic
1199822388 X:151462395-151462417 CTTCTTTCTTCCTGGCCAGCTGG + Intergenic
1200011070 X:153121229-153121251 CTTCTCTCCACCTGTGTGGCTGG - Intergenic
1200028529 X:153278693-153278715 CTTCTCTCCACCTGTGTGGCTGG + Intergenic
1200379419 X:155819358-155819380 ATTCTCTCTTCGTGTGCTGCTGG - Intergenic
1200918994 Y:8596410-8596432 TGTGTCTCTACCTGGGCTGTGGG + Intergenic
1202042521 Y:20699926-20699948 CCTCTCTTTACCTGGACTGCTGG + Intergenic